Incidental Mutation 'R7287:Tnrc6b'
ID566120
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R7287 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80879541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 415 (T415A)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067689
AA Change: T415A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: T415A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,883 R1059H possibly damaging Het
Abca3 A G 17: 24,385,887 D656G possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc8 T C 7: 46,113,110 H1209R probably damaging Het
Adam26a T C 8: 43,570,343 T37A possibly damaging Het
Adamts9 C T 6: 92,890,003 R685Q possibly damaging Het
Anapc7 T A 5: 122,433,436 N191K probably benign Het
Ankrd26 C T 6: 118,549,637 probably null Het
Ap5z1 T C 5: 142,474,047 L484P probably damaging Het
Arhgap32 A G 9: 32,152,697 D77G Het
Atp10a T A 7: 58,827,269 D1213E probably damaging Het
B3gnt8 T C 7: 25,628,970 L275P probably damaging Het
Cab39 A G 1: 85,818,461 E21G probably benign Het
Capn15 G T 17: 25,960,455 S948R probably damaging Het
Cbarp T C 10: 80,137,320 T15A unknown Het
Ccdc81 C T 7: 89,893,123 A182T probably damaging Het
Ccpg1 A G 9: 73,015,406 H766R probably benign Het
Cfl1 T C 19: 5,492,534 V14A probably benign Het
Chd6 A G 2: 161,008,392 I875T probably benign Het
Cidec T A 6: 113,428,398 E121D probably benign Het
Clpx C A 9: 65,300,013 Y64* probably null Het
Cntn1 T A 15: 92,245,952 probably null Het
Cyp24a1 A G 2: 170,485,906 L472P probably damaging Het
Dcdc2c G T 12: 28,516,686 D159E probably benign Het
Emp1 T C 6: 135,380,169 F82L probably benign Het
Fem1b T C 9: 62,796,122 T619A probably benign Het
Fgf15 A T 7: 144,896,794 D39V probably benign Het
Galnt12 T G 4: 47,108,525 F221V probably damaging Het
Herc6 A G 6: 57,651,980 probably null Het
Hspg2 G A 4: 137,529,556 V1537I probably benign Het
Ido2 T C 8: 24,535,138 probably null Het
Insr G A 8: 3,169,717 T935I probably benign Het
Itgax G A 7: 128,148,505 C1031Y probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kmt5b T C 19: 3,804,501 Y255H possibly damaging Het
Lrriq1 A T 10: 103,216,016 Y292N probably benign Het
Mrpl37 A G 4: 107,060,520 F318S probably damaging Het
Nav2 A G 7: 49,420,328 N311D probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp9b T C 7: 20,028,456 C673R probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Plce1 A T 19: 38,701,903 Q677L probably benign Het
Pmel C T 10: 128,715,226 Q113* probably null Het
Pom121l2 T A 13: 21,984,332 F924L probably benign Het
Poteg G A 8: 27,453,344 R214K probably null Het
Pprc1 G T 19: 46,071,354 S1480I unknown Het
Secisbp2l A G 2: 125,740,369 S1056P probably benign Het
Selenoo T C 15: 89,098,700 F477L probably benign Het
Senp2 A G 16: 22,018,364 D121G probably damaging Het
Slc25a11 T C 11: 70,645,355 D211G probably benign Het
Slc44a2 A G 9: 21,342,456 D131G probably benign Het
Tcf25 G A 8: 123,373,972 A34T possibly damaging Het
Tm9sf3 A G 19: 41,217,379 Y530H probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem132d G T 5: 127,984,351 Q396K probably damaging Het
Tmem154 A G 3: 84,690,563 T136A possibly damaging Het
Tonsl T C 15: 76,633,725 probably null Het
Ttyh1 T C 7: 4,125,658 Y185H probably benign Het
Ufl1 T A 4: 25,254,852 T535S probably benign Het
Vmn1r15 T C 6: 57,258,216 L23P possibly damaging Het
Vmn2r25 T A 6: 123,852,081 H78L possibly damaging Het
Vmn2r68 T C 7: 85,222,252 T608A probably benign Het
Vwf A G 6: 125,637,467 I1104V Het
Zbtb2 C T 10: 4,368,986 D347N possibly damaging Het
Zfyve9 A T 4: 108,718,256 S543T probably benign Het
Zhx1 T C 15: 58,053,296 N518S probably damaging Het
Zmym6 T C 4: 127,122,982 V852A possibly damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7453:Tnrc6b UTSW 15 80902555 small deletion probably benign
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATAGCAACCCATCTGCCTG -3'
(R):5'- CAGAGACTGTGTCAGTTCCAG -3'

Sequencing Primer
(F):5'- ATCTGCCTGGCCAGCATTG -3'
(R):5'- ACTGTGTCAGTTCCAGAAGGC -3'
Posted On2019-06-26