Incidental Mutation 'R7288:Rad50'
ID566176
Institutional Source Beutler Lab
Gene Symbol Rad50
Ensembl Gene ENSMUSG00000020380
Gene NameRAD50 double strand break repair protein
SynonymsRad50l, Mrell
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location53649519-53707319 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 53654949 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1182 (Y1182*)
Ref Sequence ENSEMBL: ENSMUSP00000020649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020649]
Predicted Effect probably null
Transcript: ENSMUST00000020649
AA Change: Y1182*
SMART Domains Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380
AA Change: Y1182*

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 1.8e-31 PFAM
coiled coil region 397 534 N/A INTRINSIC
Pfam:Rad50_zn_hook 659 712 9.9e-16 PFAM
low complexity region 825 836 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
coiled coil region 1019 1075 N/A INTRINSIC
Pfam:SbcCD_C 1174 1251 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Rad50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Rad50 APN 11 53686311 intron probably benign
IGL00709:Rad50 APN 11 53669642 missense possibly damaging 0.49
IGL01080:Rad50 APN 11 53706068 missense probably damaging 1.00
IGL01357:Rad50 APN 11 53707021 missense probably damaging 1.00
IGL01979:Rad50 APN 11 53686178 nonsense probably null
IGL02481:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02483:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02673:Rad50 APN 11 53688240 missense probably benign 0.19
IGL02754:Rad50 APN 11 53702056 missense probably damaging 1.00
IGL03372:Rad50 APN 11 53695294 missense probably benign 0.20
PIT4131001:Rad50 UTSW 11 53694899 critical splice donor site probably null
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0270:Rad50 UTSW 11 53668025 missense probably damaging 1.00
R0373:Rad50 UTSW 11 53650519 missense probably damaging 1.00
R0567:Rad50 UTSW 11 53654956 missense probably damaging 1.00
R1132:Rad50 UTSW 11 53694961 missense possibly damaging 0.58
R1249:Rad50 UTSW 11 53692137 missense probably damaging 0.99
R1368:Rad50 UTSW 11 53683245 nonsense probably null
R1501:Rad50 UTSW 11 53688151 missense possibly damaging 0.68
R1506:Rad50 UTSW 11 53679485 missense probably damaging 0.98
R1633:Rad50 UTSW 11 53692859 missense probably benign 0.00
R1663:Rad50 UTSW 11 53668223 missense probably benign 0.01
R1847:Rad50 UTSW 11 53702107 missense possibly damaging 0.68
R1933:Rad50 UTSW 11 53680061 missense probably benign 0.16
R2176:Rad50 UTSW 11 53698209 missense probably benign 0.00
R2519:Rad50 UTSW 11 53707185 start gained probably benign
R3027:Rad50 UTSW 11 53695381 missense probably benign 0.00
R3894:Rad50 UTSW 11 53678870 missense probably benign 0.01
R4181:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4302:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4836:Rad50 UTSW 11 53650653 missense probably damaging 1.00
R4934:Rad50 UTSW 11 53684275 missense probably benign 0.05
R5047:Rad50 UTSW 11 53674696 critical splice donor site probably null
R5201:Rad50 UTSW 11 53698820 critical splice donor site probably null
R5325:Rad50 UTSW 11 53692863 missense probably benign 0.16
R5368:Rad50 UTSW 11 53684246 missense probably benign 0.02
R5403:Rad50 UTSW 11 53695281 critical splice donor site probably null
R5421:Rad50 UTSW 11 53674946 missense probably benign 0.02
R6282:Rad50 UTSW 11 53669770 splice site probably null
R6468:Rad50 UTSW 11 53692144 missense possibly damaging 0.81
R6469:Rad50 UTSW 11 53684235 missense probably benign 0.08
R6528:Rad50 UTSW 11 53652282 missense probably damaging 1.00
R6704:Rad50 UTSW 11 53698918 missense probably damaging 1.00
R6886:Rad50 UTSW 11 53686184 missense probably benign 0.01
R7055:Rad50 UTSW 11 53688102 missense probably benign 0.02
R7268:Rad50 UTSW 11 53684275 missense probably benign 0.01
R7380:Rad50 UTSW 11 53695396 missense probably benign 0.00
R7467:Rad50 UTSW 11 53654908 missense probably damaging 1.00
R7533:Rad50 UTSW 11 53698919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTGTCTCACAAGGTGGC -3'
(R):5'- AGAGAGTTTGCAAGGCAGCC -3'

Sequencing Primer
(F):5'- TCTCACAAGGTGGCCAGGAAG -3'
(R):5'- GCCAGTGCTCCTAAGGACATCAG -3'
Posted On2019-06-26