Incidental Mutation 'R7290:Lhx1'
ID566339
Institutional Source Beutler Lab
Gene Symbol Lhx1
Ensembl Gene ENSMUSG00000018698
Gene NameLIM homeobox protein 1
SynonymsLim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7290 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84518284-84525535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84521877 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 163 (D163E)
Ref Sequence ENSEMBL: ENSMUSP00000018842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018842] [ENSMUST00000092827] [ENSMUST00000184646]
Predicted Effect probably damaging
Transcript: ENSMUST00000018842
AA Change: D163E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018842
Gene: ENSMUSG00000018698
AA Change: D163E

DomainStartEndE-ValueType
LIM 3 54 5.51e-17 SMART
LIM 62 117 4.24e-18 SMART
low complexity region 137 156 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092827
SMART Domains Protein: ENSMUSP00000090503
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
LIM 18 73 4.24e-18 SMART
low complexity region 93 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184646
AA Change: D72E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138899
Gene: ENSMUSG00000018698
AA Change: D72E

DomainStartEndE-ValueType
low complexity region 46 65 N/A INTRINSIC
HOX 89 151 6.8e-25 SMART
low complexity region 224 236 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations are small, fail to develop head structures anterior to rhombomere 3 in the hindbrain, lack kidneys and gonads, and show aberrant trajectories of limb motor axons. Most mutants die around embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,888 M1447L probably benign Het
Adam30 G A 3: 98,162,941 V697I probably benign Het
Adamts12 A G 15: 11,277,366 N689D probably benign Het
Adamts15 T C 9: 30,902,610 K753R probably benign Het
Adra2a T C 19: 54,046,404 F64L probably damaging Het
Ankub1 A G 3: 57,672,924 L104P probably damaging Het
Arel1 A G 12: 84,941,945 V10A probably benign Het
Atad2 A T 15: 58,098,651 N1165K probably benign Het
Atp6v0d2 T A 4: 19,880,060 D279V probably benign Het
Cadps A T 14: 12,616,099 D310E probably damaging Het
Caskin2 T C 11: 115,804,789 I249V possibly damaging Het
Cdh23 T C 10: 60,376,841 N1598S probably benign Het
Cep250 A T 2: 155,992,762 Q2202H probably benign Het
Ces5a T A 8: 93,534,683 T35S probably damaging Het
Cnot11 G A 1: 39,539,939 W295* probably null Het
Cntnap5a G T 1: 116,221,889 W565L probably damaging Het
Dgka T C 10: 128,733,599 E148G probably damaging Het
Dnah14 G A 1: 181,628,174 D955N probably benign Het
Erbin G A 13: 103,862,326 T184I probably damaging Het
Fam208a T A 14: 27,438,653 I124N probably damaging Het
Fam20c G T 5: 138,807,554 G477W probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgfr4 T C 13: 55,161,449 V433A probably benign Het
Gal3st1 A T 11: 3,998,093 Q100L possibly damaging Het
Gfra2 T C 14: 70,925,940 F221S probably damaging Het
Gm19965 G A 1: 116,821,191 V201M Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gnb1l A T 16: 18,564,056 T282S probably benign Het
Gpr171 A T 3: 59,097,726 N209K probably benign Het
Grasp G A 15: 101,231,538 S234N probably damaging Het
Greb1 G A 12: 16,711,738 T547I probably damaging Het
Ifi214 A T 1: 173,529,531 V2E probably benign Het
Ighv1-71 T C 12: 115,742,647 M1V probably null Het
Itm2b C T 14: 73,368,345 G67D probably damaging Het
Kif21a A T 15: 90,967,229 C995* probably null Het
Kifc2 A T 15: 76,660,704 Y13F probably damaging Het
Lamb1 T A 12: 31,265,596 V59D probably benign Het
Lrrc1 A T 9: 77,457,839 Y187N probably benign Het
Map3k1 C A 13: 111,768,111 V380F probably damaging Het
Mapk11 T C 15: 89,144,308 D283G probably damaging Het
Mccc2 G T 13: 99,954,699 A430D probably damaging Het
Mest A G 6: 30,747,159 N340S unknown Het
Mms22l T C 4: 24,517,139 L340P probably benign Het
Mrnip A G 11: 50,196,981 Y110C possibly damaging Het
Mtmr4 A G 11: 87,611,237 T706A probably benign Het
Ncstn A G 1: 172,072,806 F234S probably benign Het
Nrp1 T C 8: 128,476,296 probably null Het
Nup37 T G 10: 88,174,494 C217G probably damaging Het
Olfr936 A G 9: 39,047,398 L7P unknown Het
Pdzrn3 T C 6: 101,151,245 N820S probably benign Het
Pgap1 A T 1: 54,548,066 F117Y possibly damaging Het
Phip A T 9: 82,871,293 F1799L possibly damaging Het
Ppm1f T A 16: 16,910,955 F74I probably benign Het
Prpf8 C A 11: 75,493,957 N775K possibly damaging Het
Ptdss2 T C 7: 141,151,780 I167T possibly damaging Het
Ptpn18 G A 1: 34,462,811 probably null Het
Rbl2 C A 8: 91,115,041 A955D probably benign Het
Rgl1 A G 1: 152,544,395 S366P possibly damaging Het
Rit2 A T 18: 31,243,168 M38K possibly damaging Het
Robo1 A G 16: 73,004,520 M1011V probably benign Het
Senp6 A T 9: 80,136,515 E809D probably benign Het
Stard3 G A 11: 98,378,219 probably null Het
Taar3 T G 10: 23,950,400 Y281* probably null Het
Tacc2 G T 7: 130,729,373 K352N probably benign Het
Tdpoz4 G A 3: 93,796,848 V151I not run Het
Tenm2 A G 11: 36,023,471 L2413P probably damaging Het
Tgm6 T C 2: 130,141,190 V233A probably damaging Het
Tlx3 G A 11: 33,203,514 probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trim23 C A 13: 104,187,433 H133Q probably damaging Het
Unc80 A T 1: 66,601,197 D1421V probably damaging Het
Vmn1r172 A G 7: 23,660,623 N311S unknown Het
Vps25 T A 11: 101,258,949 L153Q probably damaging Het
Wbp1l G T 19: 46,623,437 probably benign Het
Ythdc2 A G 18: 44,837,491 I291V possibly damaging Het
Zfp2 A G 11: 50,900,743 C158R probably damaging Het
Zfp786 G A 6: 47,819,995 P670S probably damaging Het
Zfp827 G A 8: 79,189,813 R339H possibly damaging Het
Zmym6 C T 4: 127,123,501 A1025V possibly damaging Het
Other mutations in Lhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Lhx1 APN 11 84519652 missense probably damaging 0.97
R1346:Lhx1 UTSW 11 84522079 missense possibly damaging 0.55
R1565:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R1806:Lhx1 UTSW 11 84524141 missense probably damaging 1.00
R2148:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R2449:Lhx1 UTSW 11 84521738 missense probably damaging 1.00
R3721:Lhx1 UTSW 11 84521828 missense probably damaging 1.00
R3793:Lhx1 UTSW 11 84521900 missense probably benign 0.01
R4940:Lhx1 UTSW 11 84519909 nonsense probably null
R5178:Lhx1 UTSW 11 84520388 missense possibly damaging 0.69
R5877:Lhx1 UTSW 11 84522239 missense probably damaging 1.00
R6366:Lhx1 UTSW 11 84522208 missense probably damaging 1.00
R6551:Lhx1 UTSW 11 84521913 missense probably benign 0.23
R7060:Lhx1 UTSW 11 84520282 critical splice donor site probably null
R7106:Lhx1 UTSW 11 84522077 missense probably benign 0.00
R7133:Lhx1 UTSW 11 84519920 missense probably benign 0.00
R7161:Lhx1 UTSW 11 84519872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACCTGGATAACACGCATG -3'
(R):5'- GTGTCGCCAAAGAGAACAGC -3'

Sequencing Primer
(F):5'- CATGTTGAGGCCAGTCTCCTG -3'
(R):5'- TGAGGCGAGGATTCCCAACTG -3'
Posted On2019-06-26