Incidental Mutation 'R7291:Szt2'
ID566399
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Nameseizure threshold 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R7291 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118362743-118409273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118391249 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 655 (I655T)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
Predicted Effect probably damaging
Transcript: ENSMUST00000075406
AA Change: I655T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: I655T

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,553 E51G possibly damaging Het
9530053A07Rik A C 7: 28,140,220 D486A probably benign Het
Abca14 C A 7: 120,289,609 C1259* probably null Het
Ablim1 T C 19: 57,215,908 E17G probably benign Het
Acsf3 G A 8: 122,813,577 V505I probably benign Het
Actn1 T C 12: 80,174,085 M650V probably benign Het
Adamts4 G A 1: 171,256,528 V525I probably benign Het
Adh1 T C 3: 138,282,808 Y181H probably damaging Het
Alpl G A 4: 137,752,698 R168W probably damaging Het
Ate1 T G 7: 130,519,931 K11Q probably benign Het
Atpaf1 T A 4: 115,811,091 F314L probably damaging Het
Baiap3 T A 17: 25,244,317 D1004V probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C1s2 T A 6: 124,625,384 I623F probably benign Het
Card11 T C 5: 140,901,070 D308G probably damaging Het
Cul9 C T 17: 46,540,433 V354I probably benign Het
Dnah1 A T 14: 31,298,705 F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 I4266F possibly damaging Het
Ear10 A T 14: 43,922,920 V150D probably damaging Het
Elfn2 C T 15: 78,672,983 A455T probably benign Het
Erp44 A G 4: 48,208,792 Y223H probably damaging Het
Fam110b T A 4: 5,798,895 H104Q probably benign Het
Fcgbp A G 7: 28,101,392 N1288D probably benign Het
Fcrl1 T C 3: 87,385,781 probably null Het
Fmo2 G T 1: 162,887,702 P117Q probably benign Het
Fsip2 A G 2: 82,980,519 K2394R possibly damaging Het
Gab1 T G 8: 80,800,151 K106T probably damaging Het
Gatad2b T C 3: 90,351,414 V248A probably damaging Het
Gemin6 T C 17: 80,227,775 S55P possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Gm3250 T C 10: 77,782,227 T106A unknown Het
Gm7356 T C 17: 14,001,581 N62S probably benign Het
Gsdmc4 T C 15: 63,902,840 T31A possibly damaging Het
H2-M10.1 T A 17: 36,325,729 D61V probably damaging Het
Heatr5a A G 12: 51,925,339 L716S probably damaging Het
Hecw2 A G 1: 53,914,594 Y831H probably damaging Het
Ifi202b C T 1: 173,974,815 S151N probably benign Het
Il15ra C T 2: 11,718,381 T72I probably damaging Het
Ints1 A G 5: 139,765,074 L858P probably damaging Het
Kat2a C T 11: 100,710,900 V230I possibly damaging Het
Kcnq2 A T 2: 181,088,379 I498N possibly damaging Het
Kif26b C T 1: 178,679,046 T229I possibly damaging Het
Ly75 T A 2: 60,329,993 I957F probably damaging Het
Map3k12 T A 15: 102,502,166 R459W probably damaging Het
Mia2 T A 12: 59,158,369 probably null Het
Mrgprf A G 7: 145,307,469 I53V unknown Het
Mttp A G 3: 138,091,203 L846P probably damaging Het
Myrip C T 9: 120,417,141 L112F probably damaging Het
Nav1 A G 1: 135,465,859 F1047S probably damaging Het
Nfkbib T C 7: 28,759,203 D327G possibly damaging Het
Notch1 C T 2: 26,476,375 V776I probably benign Het
Obsl1 G T 1: 75,489,517 D1522E probably damaging Het
Olfr1464-ps1 A T 19: 13,282,153 F302I unknown Het
Olfr605 T A 7: 103,442,788 M112L probably benign Het
Olfr823 T C 10: 130,112,224 K189E probably benign Het
Olfr859 T C 9: 19,808,648 M110T possibly damaging Het
Pde7a T C 3: 19,227,674 N471D probably benign Het
Pla2r1 T C 2: 60,530,435 H203R probably benign Het
Plch2 C A 4: 154,998,472 C573F probably damaging Het
Polr1a G A 6: 71,941,456 R666Q probably benign Het
Prepl T C 17: 85,081,240 N145S probably benign Het
Psen2 C T 1: 180,238,956 V139M probably benign Het
Ptgdr A T 14: 44,859,192 M21K possibly damaging Het
Rapgef6 T C 11: 54,691,239 W1331R probably benign Het
Rp1l1 G A 14: 64,032,298 G1778S probably benign Het
Rrbp1 A T 2: 143,969,462 M824K probably benign Het
Sel1l T C 12: 91,848,965 T23A probably benign Het
Sele A G 1: 164,053,868 S515G possibly damaging Het
Slc22a23 T C 13: 34,197,839 N421D probably damaging Het
Slc35f3 T G 8: 126,394,558 L386R probably benign Het
Stab2 G A 10: 86,946,220 S699L probably damaging Het
Synrg A T 11: 84,009,381 L726F probably damaging Het
Syt3 G A 7: 44,395,919 V528M probably damaging Het
Tbr1 T C 2: 61,812,256 S622P probably damaging Het
Tex36 C T 7: 133,587,223 G207S probably benign Het
Trav5n-4 G A 14: 53,312,942 W13* probably null Het
Trdn A T 10: 33,437,736 E500V probably null Het
Ugt2b38 A T 5: 87,411,895 N379K probably damaging Het
Unc13d T C 11: 116,074,050 R248G possibly damaging Het
Vmn1r195 C T 13: 22,278,749 L130F probably damaging Het
Vmn2r110 T C 17: 20,574,209 I733V probably benign Het
Zfp870 T A 17: 32,883,854 N167I probably damaging Het
Zmynd10 A T 9: 107,549,304 M179L probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7383:Szt2 UTSW 4 118365214 nonsense probably null
X0023:Szt2 UTSW 4 118372404 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTCACGGAAAGAACTCGGC -3'
(R):5'- AGACTGGAGCAGCTTTGTGC -3'

Sequencing Primer
(F):5'- GGAAAGAACTCGGCCTTTCATGTTC -3'
(R):5'- AGGGCTATTCCTATGTCAAGC -3'
Posted On2019-06-26