Incidental Mutation 'R7291:Fcgbp'
ID566407
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene NameFc fragment of IgG binding protein
SynonymsA430096B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7291 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28071236-28120862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28101392 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1288 (N1288D)
Ref Sequence ENSEMBL: ENSMUSP00000075945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: N1288D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: N1288D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: N1288D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: N1288D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,553 E51G possibly damaging Het
9530053A07Rik A C 7: 28,140,220 D486A probably benign Het
Abca14 C A 7: 120,289,609 C1259* probably null Het
Ablim1 T C 19: 57,215,908 E17G probably benign Het
Acsf3 G A 8: 122,813,577 V505I probably benign Het
Actn1 T C 12: 80,174,085 M650V probably benign Het
Adamts4 G A 1: 171,256,528 V525I probably benign Het
Adh1 T C 3: 138,282,808 Y181H probably damaging Het
Alpl G A 4: 137,752,698 R168W probably damaging Het
Ate1 T G 7: 130,519,931 K11Q probably benign Het
Atpaf1 T A 4: 115,811,091 F314L probably damaging Het
Baiap3 T A 17: 25,244,317 D1004V probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C1s2 T A 6: 124,625,384 I623F probably benign Het
Card11 T C 5: 140,901,070 D308G probably damaging Het
Cul9 C T 17: 46,540,433 V354I probably benign Het
Dnah1 A T 14: 31,298,705 F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 I4266F possibly damaging Het
Ear10 A T 14: 43,922,920 V150D probably damaging Het
Elfn2 C T 15: 78,672,983 A455T probably benign Het
Erp44 A G 4: 48,208,792 Y223H probably damaging Het
Fam110b T A 4: 5,798,895 H104Q probably benign Het
Fcrl1 T C 3: 87,385,781 probably null Het
Fmo2 G T 1: 162,887,702 P117Q probably benign Het
Fsip2 A G 2: 82,980,519 K2394R possibly damaging Het
Gab1 T G 8: 80,800,151 K106T probably damaging Het
Gatad2b T C 3: 90,351,414 V248A probably damaging Het
Gemin6 T C 17: 80,227,775 S55P possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Gm3250 T C 10: 77,782,227 T106A unknown Het
Gm7356 T C 17: 14,001,581 N62S probably benign Het
Gsdmc4 T C 15: 63,902,840 T31A possibly damaging Het
H2-M10.1 T A 17: 36,325,729 D61V probably damaging Het
Heatr5a A G 12: 51,925,339 L716S probably damaging Het
Hecw2 A G 1: 53,914,594 Y831H probably damaging Het
Ifi202b C T 1: 173,974,815 S151N probably benign Het
Il15ra C T 2: 11,718,381 T72I probably damaging Het
Ints1 A G 5: 139,765,074 L858P probably damaging Het
Kat2a C T 11: 100,710,900 V230I possibly damaging Het
Kcnq2 A T 2: 181,088,379 I498N possibly damaging Het
Kif26b C T 1: 178,679,046 T229I possibly damaging Het
Ly75 T A 2: 60,329,993 I957F probably damaging Het
Map3k12 T A 15: 102,502,166 R459W probably damaging Het
Mia2 T A 12: 59,158,369 probably null Het
Mrgprf A G 7: 145,307,469 I53V unknown Het
Mttp A G 3: 138,091,203 L846P probably damaging Het
Myrip C T 9: 120,417,141 L112F probably damaging Het
Nav1 A G 1: 135,465,859 F1047S probably damaging Het
Nfkbib T C 7: 28,759,203 D327G possibly damaging Het
Notch1 C T 2: 26,476,375 V776I probably benign Het
Obsl1 G T 1: 75,489,517 D1522E probably damaging Het
Olfr1464-ps1 A T 19: 13,282,153 F302I unknown Het
Olfr605 T A 7: 103,442,788 M112L probably benign Het
Olfr823 T C 10: 130,112,224 K189E probably benign Het
Olfr859 T C 9: 19,808,648 M110T possibly damaging Het
Pde7a T C 3: 19,227,674 N471D probably benign Het
Pla2r1 T C 2: 60,530,435 H203R probably benign Het
Plch2 C A 4: 154,998,472 C573F probably damaging Het
Polr1a G A 6: 71,941,456 R666Q probably benign Het
Prepl T C 17: 85,081,240 N145S probably benign Het
Psen2 C T 1: 180,238,956 V139M probably benign Het
Ptgdr A T 14: 44,859,192 M21K possibly damaging Het
Rapgef6 T C 11: 54,691,239 W1331R probably benign Het
Rp1l1 G A 14: 64,032,298 G1778S probably benign Het
Rrbp1 A T 2: 143,969,462 M824K probably benign Het
Sel1l T C 12: 91,848,965 T23A probably benign Het
Sele A G 1: 164,053,868 S515G possibly damaging Het
Slc22a23 T C 13: 34,197,839 N421D probably damaging Het
Slc35f3 T G 8: 126,394,558 L386R probably benign Het
Stab2 G A 10: 86,946,220 S699L probably damaging Het
Synrg A T 11: 84,009,381 L726F probably damaging Het
Syt3 G A 7: 44,395,919 V528M probably damaging Het
Szt2 A G 4: 118,391,249 I655T probably damaging Het
Tbr1 T C 2: 61,812,256 S622P probably damaging Het
Tex36 C T 7: 133,587,223 G207S probably benign Het
Trav5n-4 G A 14: 53,312,942 W13* probably null Het
Trdn A T 10: 33,437,736 E500V probably null Het
Ugt2b38 A T 5: 87,411,895 N379K probably damaging Het
Unc13d T C 11: 116,074,050 R248G possibly damaging Het
Vmn1r195 C T 13: 22,278,749 L130F probably damaging Het
Vmn2r110 T C 17: 20,574,209 I733V probably benign Het
Zfp870 T A 17: 32,883,854 N167I probably damaging Het
Zmynd10 A T 9: 107,549,304 M179L probably benign Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ATGCCATGGTATCACCTGCC -3'
(R):5'- CTTTTAACACCAGGGTTCATTTGGC -3'

Sequencing Primer
(F):5'- TGGTATCACCTGCCGACCAC -3'
(R):5'- CAGGGTTCATTTGGCCCCATG -3'
Posted On2019-06-26