Incidental Mutation 'R7292:Cenpf'
ID566466
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R7292 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 189650694 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 2668 (L2668F)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165798
SMART Domains Protein: ENSMUSP00000132430
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_C_Rb_bdg 23 50 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171929
AA Change: L2668F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: L2668F

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
1700010I14Rik T A 17: 8,997,029 C322* probably null Het
1700019N19Rik A T 19: 58,789,107 Y90* probably null Het
2310035C23Rik G T 1: 105,721,416 probably null Het
4930553M12Rik G A 4: 88,868,331 R17C unknown Het
Abcc8 G A 7: 46,135,526 T726I probably benign Het
Adamts18 T C 8: 113,709,645 T981A probably benign Het
Adgrb3 A G 1: 25,531,876 C507R probably damaging Het
Bloc1s6 T A 2: 122,742,695 D63E probably damaging Het
Cdc25b C T 2: 131,191,173 R135W probably damaging Het
Cdca2 G T 14: 67,677,877 Y644* probably null Het
Ceacam10 G T 7: 24,778,350 G97C probably damaging Het
Cog4 A G 8: 110,881,828 D774G probably damaging Het
Col11a2 G A 17: 34,051,508 G511E unknown Het
Col19a1 T A 1: 24,530,008 I220F unknown Het
Cubn G T 2: 13,424,739 T1317K probably damaging Het
Dnaaf5 T C 5: 139,150,317 L24P unknown Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Foxn4 C A 5: 114,258,655 E256* probably null Het
Gm4869 A G 5: 140,471,670 D398G probably benign Het
Gm5580 G A 6: 116,551,477 R105Q probably damaging Het
Gnl3 A G 14: 31,013,232 S468P probably benign Het
Gzmb A T 14: 56,262,119 S11T probably benign Het
Ifi206 A G 1: 173,473,862 L750P unknown Het
Ifi213 T A 1: 173,595,125 E58V probably damaging Het
Igkv4-78 A T 6: 69,059,768 Y94N probably damaging Het
Igsf9 G T 1: 172,491,757 probably null Het
Itpr2 G T 6: 146,158,949 L2490M possibly damaging Het
Kdm2b A G 5: 122,880,791 F862S probably damaging Het
Meis1 A G 11: 19,011,351 I174T probably damaging Het
Micu3 A G 8: 40,382,125 Q507R probably benign Het
Mpp4 C T 1: 59,143,810 E313K possibly damaging Het
Nfatc4 G A 14: 55,825,055 E7K probably damaging Het
Olfr466 T A 13: 65,152,842 V206D possibly damaging Het
Olfr828 A T 9: 18,816,190 Y35N probably damaging Het
Osbpl5 G A 7: 143,701,278 P470S probably damaging Het
Pak6 A G 2: 118,693,591 D409G possibly damaging Het
Pkhd1l1 T A 15: 44,498,590 M553K probably benign Het
Ppp2r3a T C 9: 101,212,672 N151D probably damaging Het
Prdm12 T C 2: 31,643,850 W160R probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prob1 G A 18: 35,654,550 P217L possibly damaging Het
Ramp1 A C 1: 91,196,777 H20P probably benign Het
Rbm47 T A 5: 66,026,750 E170V possibly damaging Het
Rpn1 C T 6: 88,090,084 P142L probably damaging Het
Rsu1 C T 2: 13,170,016 R238H probably damaging Het
Sh3rf3 C T 10: 59,071,973 P441L probably damaging Het
Slc1a6 A G 10: 78,814,604 S559G possibly damaging Het
Slc35f5 C A 1: 125,572,485 S245R probably damaging Het
Spcs3 T C 8: 54,526,519 N76D probably benign Het
Svep1 T C 4: 58,111,395 T1075A possibly damaging Het
Sympk A T 7: 19,036,030 I211F probably benign Het
Tk1 C T 11: 117,825,777 M1I probably null Het
Tln2 A G 9: 67,346,461 V776A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tnk2 T C 16: 32,680,800 V977A probably benign Het
Toporsl A T 4: 52,611,630 S508C probably benign Het
Trank1 A C 9: 111,377,870 R1690S probably benign Het
Trio T A 15: 27,828,351 Q1409L possibly damaging Het
Vit T C 17: 78,605,498 F287L probably benign Het
Vmn2r109 G C 17: 20,541,438 D552E probably benign Het
Zw10 T C 9: 49,061,191 V186A probably benign Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7353:Cenpf UTSW 1 189654138 nonsense probably null
R7402:Cenpf UTSW 1 189659378 nonsense probably null
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATTTTAAGCGTGCACACAG -3'
(R):5'- CCAAATCCACACTGGTTGTCG -3'

Sequencing Primer
(F):5'- GAGCACGCCAGTTAGCAC -3'
(R):5'- AGTAGAGAGGGGCCTTATTTTATAC -3'
Posted On2019-06-26