Incidental Mutation 'R0635:Phka1'
ID56648
Institutional Source Beutler Lab
Gene Symbol Phka1
Ensembl Gene ENSMUSG00000034055
Gene Namephosphorylase kinase alpha 1
Synonyms9830108K24Rik, Phka
MMRRC Submission 038824-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0635 (G1)
Quality Score225
Status Validated
ChromosomeX
Chromosomal Location102513975-102644246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102621400 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 186 (R186C)
Ref Sequence ENSEMBL: ENSMUSP00000112529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043596] [ENSMUST00000052012] [ENSMUST00000113611] [ENSMUST00000119229] [ENSMUST00000120270] [ENSMUST00000122022]
Predicted Effect probably damaging
Transcript: ENSMUST00000043596
AA Change: R186C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042778
Gene: ENSMUSG00000034055
AA Change: R186C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 864 5.6e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052012
AA Change: R186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061991
Gene: ENSMUSG00000034055
AA Change: R186C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.8e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113611
AA Change: R186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109241
Gene: ENSMUSG00000034055
AA Change: R186C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.5e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119229
AA Change: R186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114066
Gene: ENSMUSG00000034055
AA Change: R186C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120270
AA Change: R186C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113302
Gene: ENSMUSG00000034055
AA Change: R186C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.3e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122022
AA Change: R186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112529
Gene: ENSMUSG00000034055
AA Change: R186C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.6e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142534
Meta Mutation Damage Score 0.6816 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the skeletal muscle isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9D, also known as X-linked muscle glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. A pseudogene has been found on chromosome 1.[provided by RefSeq, Feb 2010]
PHENOTYPE: PHK activity is nearly absent in I/Ln skeletal muscle and reduced in brain, heart and kidney. The I-allele sequence is known to have a single nucleotide insertion (frameshift). A different allele in strain V reduces PHK activity to 25% and is dominant tonormal and I-strain alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,143 L369S probably benign Het
4932429P05Rik T C X: 89,752,522 probably benign Het
5730455P16Rik A T 11: 80,374,065 probably benign Het
Adamts15 A G 9: 30,904,770 L631P probably damaging Het
Adamts17 T C 7: 66,908,605 F266L probably damaging Het
Adgrb1 C A 15: 74,540,892 Q488K possibly damaging Het
Cep290 A G 10: 100,492,676 D109G probably damaging Het
Chil5 A T 3: 106,017,203 Y229N possibly damaging Het
Cntnap1 A G 11: 101,183,459 T742A probably benign Het
Col6a3 A T 1: 90,808,086 probably null Het
Col6a5 G A 9: 105,928,606 P1034S unknown Het
Daxx T A 17: 33,912,644 D442E probably benign Het
Dmxl1 T C 18: 49,851,423 probably benign Het
Dnah11 A G 12: 118,007,996 F2942S probably damaging Het
Fam71a T C 1: 191,163,727 T240A probably benign Het
Glg1 A G 8: 111,163,764 probably benign Het
Gm10272 G A 10: 77,706,701 probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Haao A G 17: 83,838,574 F83S probably damaging Het
Hdgfl2 T A 17: 56,096,057 L177Q probably damaging Het
Hrh1 T C 6: 114,480,145 V129A probably damaging Het
Ift43 T A 12: 86,085,081 probably benign Het
Il21r T C 7: 125,632,506 Y369H probably damaging Het
Il2ra C T 2: 11,680,366 T171M probably benign Het
Lao1 C T 4: 118,968,296 R438C probably benign Het
Lrrcc1 G A 3: 14,559,228 S350N probably benign Het
Mageb5 T A X: 91,779,993 Y260F probably benign Het
March5 A T 19: 37,220,408 I159F possibly damaging Het
Mgat4a G A 1: 37,452,294 A282V probably benign Het
Mipep G A 14: 60,829,390 V420I probably damaging Het
Morc2b A T 17: 33,137,687 F370L possibly damaging Het
Mt1 A T 8: 94,179,821 probably null Het
Ncapd2 A G 6: 125,173,036 V943A probably benign Het
Nkd2 T C 13: 73,826,894 D58G probably benign Het
Nol8 C G 13: 49,676,758 S1106C probably benign Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Nusap1 A G 2: 119,627,667 T95A probably damaging Het
Ocln T A 13: 100,506,236 Q197L probably damaging Het
Olfr495 T A 7: 108,395,764 F215I probably benign Het
Oxtr A G 6: 112,489,200 Y200H probably damaging Het
Paip2b T C 6: 83,809,909 E115G possibly damaging Het
Pcm1 T A 8: 41,267,179 probably benign Het
Pcnt T C 10: 76,404,585 D1205G probably damaging Het
Pik3cb A G 9: 99,064,218 probably benign Het
Pik3r1 C T 13: 101,757,418 R81K probably benign Het
Ppa1 A G 10: 61,665,440 D162G probably benign Het
Ppa1 A G 10: 61,666,970 R191G probably damaging Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Rgr T A 14: 37,038,947 R218* probably null Het
Rreb1 A T 13: 37,941,564 Q1282L possibly damaging Het
Scel T A 14: 103,583,139 probably null Het
Sema6b A G 17: 56,129,971 probably null Het
Slc4a1 T C 11: 102,352,672 E711G possibly damaging Het
Snx19 C A 9: 30,428,810 L415M probably damaging Het
Snx19 T G 9: 30,428,811 L415R probably damaging Het
Specc1 G A 11: 62,118,903 R495Q probably damaging Het
Tead1 T C 7: 112,891,706 probably benign Het
Timm10b A C 7: 105,640,688 probably benign Het
Ubxn7 T A 16: 32,367,417 probably benign Het
Vmn2r116 T A 17: 23,386,887 Y258N possibly damaging Het
Vmn2r77 T A 7: 86,811,175 F570I probably benign Het
Vmn2r98 T C 17: 19,080,497 V587A probably benign Het
Zfp398 T C 6: 47,863,140 I101T probably damaging Het
Zfp808 T A 13: 62,172,419 H487Q probably damaging Het
Other mutations in Phka1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Phka1 APN X 102586106 missense probably damaging 0.99
IGL02561:Phka1 APN X 102598289 splice site probably benign
IGL03201:Phka1 APN X 102541110 critical splice donor site probably null
IGL03294:Phka1 APN X 102537213 missense probably damaging 1.00
R0626:Phka1 UTSW X 102520831 missense probably damaging 1.00
R0709:Phka1 UTSW X 102586104 missense probably damaging 0.98
R1399:Phka1 UTSW X 102617358 missense probably damaging 1.00
R2114:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2115:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2117:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2267:Phka1 UTSW X 102541110 critical splice donor site probably benign
R2268:Phka1 UTSW X 102541110 critical splice donor site probably benign
R4463:Phka1 UTSW X 102545384 missense probably benign
X0022:Phka1 UTSW X 102621345 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGAGACATGCCTTAAAAGCCAT -3'
(R):5'- ACCAACTGTTGCTTAGCCTCTATGTG -3'

Sequencing Primer
(F):5'- GACATGCCTTAAAAGCCATATGATTC -3'
(R):5'- CATGGGAATCTCCTTTAGGGAAAAC -3'
Posted On2013-07-11