Incidental Mutation 'R7293:Cyb5rl'
ID566539
Institutional Source Beutler Lab
Gene Symbol Cyb5rl
Ensembl Gene ENSMUSG00000028621
Gene Namecytochrome b5 reductase-like
Synonyms2810410C14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7293 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107066988-107088268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107080946 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 165 (I165T)
Ref Sequence ENSEMBL: ENSMUSP00000030364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000106756] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000127916] [ENSMUST00000137269] [ENSMUST00000149453]
Predicted Effect probably damaging
Transcript: ENSMUST00000030364
AA Change: I165T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621
AA Change: I165T

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106756
AA Change: I140T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102367
Gene: ENSMUSG00000028621
AA Change: I140T

DomainStartEndE-ValueType
Pfam:FAD_binding_6 20 117 4.7e-23 PFAM
Pfam:NAD_binding_1 127 241 3.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106758
AA Change: I200T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621
AA Change: I200T

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106760
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126207
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127916
Predicted Effect probably benign
Transcript: ENSMUST00000137269
SMART Domains Protein: ENSMUSP00000119249
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:FAD_binding_6 13 110 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149453
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Cyb5rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cyb5rl APN 4 107084296 missense probably benign 0.21
IGL01350:Cyb5rl APN 4 107084212 missense possibly damaging 0.77
IGL02418:Cyb5rl APN 4 107070985 missense probably damaging 1.00
IGL02746:Cyb5rl APN 4 107068639 missense probably benign 0.12
IGL03088:Cyb5rl APN 4 107081028 nonsense probably null
IGL03279:Cyb5rl APN 4 107084128 missense possibly damaging 0.95
R1301:Cyb5rl UTSW 4 107080907 missense probably damaging 1.00
R1731:Cyb5rl UTSW 4 107080913 missense probably damaging 1.00
R2091:Cyb5rl UTSW 4 107071006 missense probably damaging 1.00
R2165:Cyb5rl UTSW 4 107068683 missense probably damaging 1.00
R2504:Cyb5rl UTSW 4 107080945 missense probably benign 0.01
R4223:Cyb5rl UTSW 4 107080988 missense probably damaging 0.97
R4851:Cyb5rl UTSW 4 107084313 missense probably benign 0.39
R4964:Cyb5rl UTSW 4 107069132 intron probably benign
R5797:Cyb5rl UTSW 4 107084207 missense possibly damaging 0.69
R6575:Cyb5rl UTSW 4 107085353 missense probably benign 0.20
R6688:Cyb5rl UTSW 4 107073905 missense probably damaging 0.99
R6986:Cyb5rl UTSW 4 107070876 missense probably benign 0.18
R7097:Cyb5rl UTSW 4 107087316 missense unknown
R7139:Cyb5rl UTSW 4 107071011 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTCATGCACCAAGGGAAGAG -3'
(R):5'- CACAAAGGGAATGCAGTTCG -3'

Sequencing Primer
(F):5'- CATGGCAGAGACGGGTG -3'
(R):5'- CAGTTCGTTAGGGGAGAGGTCC -3'
Posted On2019-06-26