Incidental Mutation 'R7293:Ncan'
ID566557
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Nameneurocan
SynonymsCspg3, Cspg3-rs, neurocan, Tgfbit
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7293 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70093085-70120873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70115211 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 84 (S84T)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
Predicted Effect probably damaging
Transcript: ENSMUST00000002412
AA Change: S84T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: S84T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACCACTTGGCAGCGATACAG -3'
(R):5'- AAATGTTAGTGCCCACCCC -3'

Sequencing Primer
(F):5'- ATACAGCCCAGAGTCGCTTG -3'
(R):5'- ACCCCTACCTCTGACTCAGG -3'
Posted On2019-06-26