Incidental Mutation 'R7293:Amhr2'
ID566588
Institutional Source Beutler Lab
Gene Symbol Amhr2
Ensembl Gene ENSMUSG00000023047
Gene Nameanti-Mullerian hormone type 2 receptor
SynonymsMIS TypeII receptor, MISIIR
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R7293 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location102445367-102454633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102447393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000023809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023809] [ENSMUST00000229278] [ENSMUST00000229566]
Predicted Effect probably benign
Transcript: ENSMUST00000023809
AA Change: T258A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023809
Gene: ENSMUSG00000023047
AA Change: T258A

DomainStartEndE-ValueType
Pfam:Activin_recp 46 124 3.4e-7 PFAM
transmembrane domain 146 168 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Pfam:Pkinase 199 501 4.6e-25 PFAM
Pfam:Pkinase_Tyr 199 501 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162893
SMART Domains Protein: ENSMUSP00000123735
Gene: ENSMUSG00000023047

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 3 73 2.4e-8 PFAM
Pfam:Pkinase 6 84 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229278
AA Change: T258A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000229566
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract, but also a uterus and oviducts. Functional sperm are produced, but most males are infertile because female reproductive organs block sperm transfer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Amhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02273:Amhr2 APN 15 102452489 missense probably benign 0.02
IGL02941:Amhr2 APN 15 102447289 missense probably damaging 1.00
R0269:Amhr2 UTSW 15 102447068 missense probably benign 0.39
R0645:Amhr2 UTSW 15 102446428 missense probably damaging 1.00
R1128:Amhr2 UTSW 15 102452821 missense probably benign 0.10
R1857:Amhr2 UTSW 15 102446777 nonsense probably null
R3500:Amhr2 UTSW 15 102447066 missense probably benign 0.01
R3882:Amhr2 UTSW 15 102445898 missense probably damaging 1.00
R4661:Amhr2 UTSW 15 102454253 missense probably damaging 1.00
R4980:Amhr2 UTSW 15 102454330 missense probably benign 0.00
R5053:Amhr2 UTSW 15 102447258 missense probably damaging 1.00
R7003:Amhr2 UTSW 15 102446333 missense probably benign 0.00
R7016:Amhr2 UTSW 15 102454364 missense possibly damaging 0.63
X0013:Amhr2 UTSW 15 102452752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGCAGCCTCTCTACTAGG -3'
(R):5'- TGAGTTTAGAGAGCTACTCCTGG -3'

Sequencing Primer
(F):5'- CTCTCTACTAGGTAATCCAGGAAGG -3'
(R):5'- GGAGTGGAACATGCCTTTAATCCC -3'
Posted On2019-06-26