Incidental Mutation 'R7294:Pdgfra'
ID566614
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7294 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75181651 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 711 (N711S)
Ref Sequence ENSEMBL: ENSMUSP00000000476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162] [ENSMUST00000201711] [ENSMUST00000202681]
Predicted Effect probably benign
Transcript: ENSMUST00000000476
AA Change: N711S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: N711S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168162
AA Change: N711S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: N711S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201711
AA Change: N711S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143891
Gene: ENSMUSG00000029231
AA Change: N711S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202681
AA Change: N711S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143906
Gene: ENSMUSG00000029231
AA Change: N711S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,673,582 Y1216* probably null Het
Abca17 G A 17: 24,321,009 T415M not run Het
Adam1a G T 5: 121,520,005 C408* probably null Het
Adamts9 G A 6: 92,894,289 T603M probably damaging Het
Amdhd1 T C 10: 93,534,439 E179G probably benign Het
Bcan T C 3: 87,995,524 T316A possibly damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C5ar1 T C 7: 16,249,025 I23M probably benign Het
Cd109 A T 9: 78,712,635 E1386D probably damaging Het
Cdcp1 C T 9: 123,177,921 C587Y probably benign Het
Cdh22 A C 2: 165,142,093 V413G possibly damaging Het
Col6a3 A T 1: 90,828,283 Y95N probably damaging Het
Dusp13 A G 14: 21,733,714 S178P possibly damaging Het
Fhod3 A G 18: 25,132,980 E1575G probably damaging Het
Gfpt2 C T 11: 49,818,608 R209* probably null Het
Gm12169 T A 11: 46,535,612 I182K probably benign Het
Heg1 T C 16: 33,726,489 S573P probably damaging Het
Hinfp A G 9: 44,299,270 C152R probably damaging Het
Hmgcs2 C T 3: 98,290,895 T38I probably benign Het
Jakmip1 T C 5: 37,117,460 F441L possibly damaging Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Krt15 T A 11: 100,132,022 I456F possibly damaging Het
Leprotl1 A T 8: 34,138,852 probably null Het
Muc4 A T 16: 32,756,461 T42S possibly damaging Het
Nat6 T G 9: 107,582,983 F26V possibly damaging Het
Nr1h5 T C 3: 102,945,262 T419A probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1259 A C 2: 89,943,724 Y130* probably null Het
Olfr549 T A 7: 102,554,953 I223N probably damaging Het
Pax6 T A 2: 105,684,901 C66* probably null Het
Pde10a A T 17: 8,757,021 N53Y probably benign Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Slc26a1 G T 5: 108,673,832 R80S possibly damaging Het
Slc2a4 T C 11: 69,945,399 D262G probably benign Het
Specc1 T A 11: 62,118,337 S226R probably benign Het
Srsf4 A G 4: 131,900,461 S289G unknown Het
Stil T C 4: 115,007,283 V127A probably benign Het
Syne1 A T 10: 5,097,483 probably null Het
Tbc1d22a T A 15: 86,311,835 Y336N possibly damaging Het
Tbc1d8 C T 1: 39,406,762 G116E probably damaging Het
Thrb A G 14: 17,826,963 probably benign Het
Tln1 G T 4: 43,534,399 H2253Q probably benign Het
Tmem131 A C 1: 36,854,847 N158K possibly damaging Het
Toporsl A C 4: 52,611,903 T599P probably benign Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Triobp C T 15: 78,973,976 A1259V probably damaging Het
Zfp40 A G 17: 23,176,437 I392T possibly damaging Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTCATACGTGGAGCTCAC -3'
(R):5'- TGTGTACCCATCCACACTGAC -3'

Sequencing Primer
(F):5'- GGTCCCCCGACTTTTTGGAAG -3'
(R):5'- ATCCACACTGACGCGGATG -3'
Posted On2019-06-26