Incidental Mutation 'R7295:Gtpbp3'
ID566676
Institutional Source Beutler Lab
Gene Symbol Gtpbp3
Ensembl Gene ENSMUSG00000007610
Gene NameGTP binding protein 3
Synonyms2410009F13Rik, Gtpbp3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R7295 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location71488103-71499583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71489495 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 123 (S123R)
Ref Sequence ENSEMBL: ENSMUSP00000007754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847] [ENSMUST00000213382]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007754
AA Change: S123R

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610
AA Change: S123R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093450
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095259
AA Change: S123R

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610
AA Change: S123R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127741
AA Change: S123R

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610
AA Change: S123R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150969
AA Change: S123R

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610
AA Change: S123R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168847
AA Change: S124R

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610
AA Change: S124R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213382
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a GTP-binding protein. The encoded protein is localized to the mitochondria and may play a role in mitochondrial tRNA modification. Polymorphisms at this locus may be associated with severity of aminoglycoside-induced deafness, a disease associated with a mutation in the 12S rRNA. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Acp7 A T 7: 28,629,530 F75Y possibly damaging Het
Adamts19 T A 18: 58,837,883 Y180N probably damaging Het
Adck1 G T 12: 88,431,045 D150Y probably damaging Het
Alb T A 5: 90,462,834 probably null Het
Baat A T 4: 49,490,275 Y270N probably damaging Het
Bmp7 A T 2: 172,939,897 I58N probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
Cbfa2t3 T G 8: 122,638,029 D338A probably benign Het
Ccnd2 A T 6: 127,148,762 C104S possibly damaging Het
Clip1 G T 5: 123,627,356 Q713K probably benign Het
Ddx28 G A 8: 106,010,844 S194L probably benign Het
Dync1h1 T C 12: 110,664,749 probably null Het
Edil3 T A 13: 89,131,783 Y193* probably null Het
Eprs A G 1: 185,418,210 probably null Het
Ercc6l2 T G 13: 63,819,775 I63R probably damaging Het
Fam171a2 T C 11: 102,438,238 E565G possibly damaging Het
Fbn1 T A 2: 125,335,487 D1810V probably damaging Het
Foxj2 T C 6: 122,840,231 S506P probably benign Het
Frmpd1 A G 4: 45,285,700 E1507G probably damaging Het
Gfm1 G A 3: 67,440,181 V258I probably benign Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gphn T C 12: 78,492,102 V174A probably benign Het
Hbs1l T C 10: 21,310,152 V491A probably benign Het
Hist1h2bg T C 13: 23,571,769 S113P probably benign Het
Hoxc12 A G 15: 102,938,375 N234S probably damaging Het
Iltifb A T 10: 118,294,943 L16* probably null Het
Kcnj5 T C 9: 32,322,791 D76G probably damaging Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Lonp1 G T 17: 56,622,495 Q181K possibly damaging Het
Mgst1 A T 6: 138,147,756 I23F probably benign Het
Myocos T C 1: 162,657,118 R41G unknown Het
Myod1 A G 7: 46,378,219 D261G probably benign Het
Nop14 C T 5: 34,639,032 R781Q probably damaging Het
Nsmaf A G 4: 6,438,083 V63A probably benign Het
Ntsr1 A T 2: 180,500,932 H172L probably damaging Het
Olfr731 T C 14: 50,238,616 K90E probably damaging Het
Olfr905 A T 9: 38,473,443 E232V probably benign Het
Pcdha11 T C 18: 37,006,926 V536A probably damaging Het
Pcdha6 T A 18: 36,968,136 N127K probably damaging Het
Prps1l1 T A 12: 34,985,680 C265S probably benign Het
Prune2 A G 19: 17,119,897 S922G probably benign Het
Qpctl A T 7: 19,149,130 M19K probably benign Het
Rad51 C T 2: 119,134,118 T230I possibly damaging Het
Rad9b A G 5: 122,334,278 F246L possibly damaging Het
Rarb A T 14: 16,508,932 probably null Het
Sdcbp2 T C 2: 151,587,401 S214P possibly damaging Het
Slc22a1 T A 17: 12,657,005 M441L probably benign Het
Slc35f1 G A 10: 53,062,541 V190I probably benign Het
Spon1 A T 7: 114,030,240 Q373L possibly damaging Het
Sult1e1 T A 5: 87,578,653 R201* probably null Het
Traj32 T A 14: 54,186,149 L16Q Het
Ttc16 T C 2: 32,774,425 I67V probably null Het
Ttn T A 2: 76,726,555 K30035N probably damaging Het
Ttn T A 2: 76,946,129 Y1607F unknown Het
Usp16 G A 16: 87,472,089 R290H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Xpnpep3 A G 15: 81,414,534 H56R probably damaging Het
Zfp592 G T 7: 81,024,322 D345Y probably damaging Het
Zfp931 A T 2: 178,068,031 Y187* probably null Het
Other mutations in Gtpbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Gtpbp3 APN 8 71490434 missense probably damaging 1.00
IGL02476:Gtpbp3 APN 8 71492598 missense probably damaging 1.00
IGL02669:Gtpbp3 APN 8 71490902 missense probably damaging 1.00
IGL02885:Gtpbp3 APN 8 71489420 unclassified probably benign
IGL03038:Gtpbp3 APN 8 71489303 missense possibly damaging 0.94
R0267:Gtpbp3 UTSW 8 71491497 missense probably damaging 1.00
R0442:Gtpbp3 UTSW 8 71491491 missense probably damaging 0.97
R0639:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R0673:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R1844:Gtpbp3 UTSW 8 71492628 missense probably benign 0.05
R1957:Gtpbp3 UTSW 8 71490455 missense probably damaging 1.00
R2996:Gtpbp3 UTSW 8 71489496 missense possibly damaging 0.69
R3703:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R3705:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R4084:Gtpbp3 UTSW 8 71490512 missense probably benign 0.00
R4181:Gtpbp3 UTSW 8 71491467 missense probably damaging 1.00
R4705:Gtpbp3 UTSW 8 71491114 missense probably benign 0.23
R5081:Gtpbp3 UTSW 8 71490382 missense probably damaging 1.00
R5260:Gtpbp3 UTSW 8 71489418 unclassified probably benign
R5619:Gtpbp3 UTSW 8 71491048 intron probably benign
R5844:Gtpbp3 UTSW 8 71492555 missense probably benign 0.01
R6666:Gtpbp3 UTSW 8 71490938 missense possibly damaging 0.61
R7092:Gtpbp3 UTSW 8 71492265 missense probably benign
X0013:Gtpbp3 UTSW 8 71492693 missense possibly damaging 0.77
X0021:Gtpbp3 UTSW 8 71490517 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGTGCAGAGTCCTTAGTCCC -3'
(R):5'- ACTCGGGTTCACATTTGGC -3'

Sequencing Primer
(F):5'- AGAGTCCTTAGTCCCCAGCAG -3'
(R):5'- GGCAACAATCACCTTTACTGG -3'
Posted On2019-06-26