Incidental Mutation 'R7297:Nrg3'
ID566767
Institutional Source Beutler Lab
Gene Symbol Nrg3
Ensembl Gene ENSMUSG00000041014
Gene Nameneuregulin 3
Synonymsska
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location38368952-39473088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38370939 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 579 (D579G)
Ref Sequence ENSEMBL: ENSMUSP00000136884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166968] [ENSMUST00000168810] [ENSMUST00000173780]
Predicted Effect probably benign
Transcript: ENSMUST00000166968
AA Change: D579G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136884
Gene: ENSMUSG00000041014
AA Change: D579G

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
Pfam:Neuregulin 355 480 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168810
AA Change: D563G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129783
Gene: ENSMUSG00000041014
AA Change: D563G

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173780
AA Change: D555G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134727
Gene: ENSMUSG00000041014
AA Change: D555G

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuregulin gene family. This gene family encodes ligands for the transmembrane tyrosine kinase receptors ERBB3 and ERBB4 - members of the epidermal growth factor receptor family. Ligand binding activates intracellular signaling cascades and the induction of cellular responses including proliferation, migration, differentiation, and survival or apoptosis. This gene encodes neuregulin 3 (NRG3). NRG3 has been shown to activate the tyrosine phosphorylation of its cognate receptor, ERBB4, and is thought to influence neuroblast proliferation, migration and differentiation by signalling through ERBB4. NRG3 also promotes mammary differentiation during embryogenesis. Linkage studies have implicated this gene as a susceptibility locus for schizophrenia and schizoaffective disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but their biological validity has not been verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mutations in this gene result in abnormal, genetic background specific, mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Nrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Nrg3 APN 14 38370801 missense probably damaging 0.99
IGL01994:Nrg3 APN 14 39012086 missense probably damaging 1.00
IGL02002:Nrg3 APN 14 38370767 nonsense probably null
IGL02247:Nrg3 APN 14 38371312 missense probably damaging 0.98
IGL02967:Nrg3 APN 14 38668299 splice site probably benign
FR4304:Nrg3 UTSW 14 38397273 small insertion probably benign
FR4449:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4548:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4589:Nrg3 UTSW 14 38397266 small insertion probably benign
R0178:Nrg3 UTSW 14 38376456 missense probably damaging 1.00
R0825:Nrg3 UTSW 14 39472391 missense possibly damaging 0.67
R1545:Nrg3 UTSW 14 38407154 missense probably benign 0.03
R2009:Nrg3 UTSW 14 38370814 missense probably damaging 0.99
R2022:Nrg3 UTSW 14 38376352 missense probably damaging 0.98
R2264:Nrg3 UTSW 14 38381702 missense probably damaging 1.00
R2937:Nrg3 UTSW 14 38371008 missense possibly damaging 0.94
R2958:Nrg3 UTSW 14 39472712 missense unknown
R3085:Nrg3 UTSW 14 38370949 missense probably damaging 0.99
R3801:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R3803:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R4246:Nrg3 UTSW 14 39472241 missense possibly damaging 0.58
R5584:Nrg3 UTSW 14 39472697 small deletion probably benign
R5625:Nrg3 UTSW 14 38370993 missense probably damaging 0.99
R5870:Nrg3 UTSW 14 39472629 missense possibly damaging 0.95
R6007:Nrg3 UTSW 14 39472452 nonsense probably null
R6047:Nrg3 UTSW 14 38397352 critical splice acceptor site probably null
R6294:Nrg3 UTSW 14 38397239 missense probably benign 0.00
R6803:Nrg3 UTSW 14 39012000 nonsense probably null
R7023:Nrg3 UTSW 14 38376376 missense probably damaging 1.00
R7159:Nrg3 UTSW 14 38370735 nonsense probably null
R7194:Nrg3 UTSW 14 39472478 missense probably benign 0.17
X0020:Nrg3 UTSW 14 38397241 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCACTGACTGGCATACTCGC -3'
(R):5'- CAGGAAGACTATATCCCACCTG -3'

Sequencing Primer
(F):5'- ACTCGCGTTGACAATGTCAG -3'
(R):5'- TGTGACCTTGAGCAAGTCAC -3'
Posted On2019-06-26