Incidental Mutation 'R7297:Arap3'
ID566778
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
SynonymsDRAG1, E030006K04Rik, Centd3
Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37972624-37997574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37973563 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1409 (A1409V)
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944] [ENSMUST00000043437] [ENSMUST00000163131] [ENSMUST00000164222] [ENSMUST00000166148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042944
AA Change: A1409V

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: A1409V

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043437
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163131
SMART Domains Protein: ENSMUSP00000133058
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 12 107 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164222
SMART Domains Protein: ENSMUSP00000128481
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 12 56 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166148
SMART Domains Protein: ENSMUSP00000129825
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 12 93 1.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 37975926 missense probably damaging 1.00
IGL01145:Arap3 APN 18 37989179 missense probably benign
IGL01154:Arap3 APN 18 37996734 missense probably benign 0.28
IGL01305:Arap3 APN 18 37991327 critical splice donor site probably null
IGL01542:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01543:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01544:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01545:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01677:Arap3 APN 18 37996647 missense probably benign
IGL01925:Arap3 APN 18 37984246 missense probably benign 0.21
IGL01933:Arap3 APN 18 37978453 missense possibly damaging 0.65
IGL02048:Arap3 APN 18 37996979 missense possibly damaging 0.56
IGL02064:Arap3 APN 18 37991701 missense probably damaging 1.00
IGL02207:Arap3 APN 18 37987853 missense probably benign 0.00
IGL02376:Arap3 APN 18 37978453 missense possibly damaging 0.95
IGL02531:Arap3 APN 18 37989751 missense probably damaging 0.99
IGL02568:Arap3 APN 18 37996658 missense probably benign 0.32
IGL02640:Arap3 APN 18 37987802 missense possibly damaging 0.71
IGL02658:Arap3 APN 18 37990994 missense probably benign 0.09
IGL03090:Arap3 APN 18 37989112 missense probably benign 0.00
IGL03352:Arap3 APN 18 37981302 splice site probably benign
ANU22:Arap3 UTSW 18 37991327 critical splice donor site probably null
P0016:Arap3 UTSW 18 37984348 missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 37996895 missense probably benign 0.08
R0066:Arap3 UTSW 18 37996707 missense probably benign 0.01
R0324:Arap3 UTSW 18 37973225 missense possibly damaging 0.93
R0562:Arap3 UTSW 18 37975540 missense probably damaging 1.00
R1289:Arap3 UTSW 18 37981973 missense possibly damaging 0.95
R1346:Arap3 UTSW 18 37975918 missense probably damaging 1.00
R1419:Arap3 UTSW 18 37978432 missense possibly damaging 0.51
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1537:Arap3 UTSW 18 37989684 critical splice donor site probably null
R1644:Arap3 UTSW 18 37984245 missense probably damaging 1.00
R1731:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1758:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1843:Arap3 UTSW 18 37975583 missense probably damaging 1.00
R1907:Arap3 UTSW 18 37996671 missense probably benign 0.28
R1954:Arap3 UTSW 18 37982002 missense probably damaging 1.00
R2124:Arap3 UTSW 18 37973350 missense probably damaging 0.98
R2135:Arap3 UTSW 18 37974456 missense probably damaging 1.00
R2172:Arap3 UTSW 18 37990560 missense probably damaging 1.00
R2418:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2419:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2907:Arap3 UTSW 18 37990527 missense possibly damaging 0.88
R4425:Arap3 UTSW 18 37978600 missense probably damaging 1.00
R4669:Arap3 UTSW 18 37996254 missense probably benign 0.08
R4734:Arap3 UTSW 18 37996275 missense probably benign 0.00
R4815:Arap3 UTSW 18 37973243 missense probably benign
R5328:Arap3 UTSW 18 37991687 missense possibly damaging 0.92
R5350:Arap3 UTSW 18 37982035 missense probably damaging 1.00
R5466:Arap3 UTSW 18 37996736 missense probably benign 0.00
R5482:Arap3 UTSW 18 37974674 missense possibly damaging 0.95
R5572:Arap3 UTSW 18 37991066 missense probably damaging 1.00
R5779:Arap3 UTSW 18 37984365 missense probably damaging 1.00
R6053:Arap3 UTSW 18 37990771 missense probably damaging 0.98
R6144:Arap3 UTSW 18 37985433 missense probably damaging 0.98
R6166:Arap3 UTSW 18 37974370 missense probably damaging 1.00
R6248:Arap3 UTSW 18 37991354 missense probably benign 0.09
R6266:Arap3 UTSW 18 37990791 missense probably damaging 0.98
R6385:Arap3 UTSW 18 37997031 nonsense probably null
R6694:Arap3 UTSW 18 37991537 critical splice donor site probably null
R6856:Arap3 UTSW 18 37979863 missense possibly damaging 0.95
R7073:Arap3 UTSW 18 37974442 nonsense probably null
R7352:Arap3 UTSW 18 37973278 missense probably benign 0.00
X0011:Arap3 UTSW 18 37974101 critical splice donor site probably null
X0026:Arap3 UTSW 18 37985311 critical splice donor site probably null
X0027:Arap3 UTSW 18 37973485 unclassified probably null
X0066:Arap3 UTSW 18 37991646 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCAGCTGTTCCTCTAGGG -3'
(R):5'- TTTGTAGTGTCTGACTCAAGGAAG -3'

Sequencing Primer
(F):5'- GCCTGAGAACTGCTTTTTGAAG -3'
(R):5'- TCTGACTCAAGGAAGAACGTGACC -3'
Posted On2019-06-26