Incidental Mutation 'R7299:Cog6'
ID566839
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Namecomponent of oligomeric golgi complex 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7299 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location52981875-53017237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53002507 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 275 (S275G)
Ref Sequence ENSEMBL: ENSMUSP00000048603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]
Predicted Effect probably benign
Transcript: ENSMUST00000036665
AA Change: S275G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: S275G

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193432
AA Change: S275G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: S275G

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195183
SMART Domains Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:COG6 39 174 5.5e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
Armc4 T C 18: 7,222,635 K545E probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnga1 T C 5: 72,605,432 I246M probably benign Het
Cnot7 A G 8: 40,507,545 I74T probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gata4 T A 14: 63,203,742 T276S probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52986425 missense probably benign 0.03
IGL01946:Cog6 APN 3 53002404 intron probably benign
IGL02122:Cog6 APN 3 52998342 missense probably benign 0.04
IGL02589:Cog6 APN 3 53007270 missense probably damaging 1.00
IGL02819:Cog6 APN 3 53009545 missense probably damaging 0.98
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0086:Cog6 UTSW 3 52993570 missense probably damaging 0.98
R0545:Cog6 UTSW 3 52996075 missense probably damaging 1.00
R0707:Cog6 UTSW 3 53013862 missense possibly damaging 0.71
R0718:Cog6 UTSW 3 53010629 missense probably benign 0.35
R1169:Cog6 UTSW 3 53013844 missense probably benign 0.30
R1451:Cog6 UTSW 3 53009113 missense possibly damaging 0.78
R1891:Cog6 UTSW 3 52983180 missense probably benign
R2249:Cog6 UTSW 3 53000479 critical splice donor site probably null
R2264:Cog6 UTSW 3 52992911 nonsense probably null
R3745:Cog6 UTSW 3 52992819 missense probably benign 0.05
R4027:Cog6 UTSW 3 53002529 missense possibly damaging 0.95
R4230:Cog6 UTSW 3 52992808 missense probably benign 0.13
R4400:Cog6 UTSW 3 53012941 missense probably benign 0.11
R4551:Cog6 UTSW 3 52998320 missense probably damaging 1.00
R4866:Cog6 UTSW 3 53010598 missense probably benign 0.10
R5326:Cog6 UTSW 3 53013816 missense probably null 0.12
R6169:Cog6 UTSW 3 53007301 missense probably benign 0.03
R6273:Cog6 UTSW 3 52996052 missense probably damaging 1.00
R7169:Cog6 UTSW 3 52989966 missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52983189 missense probably benign 0.21
R7243:Cog6 UTSW 3 53002315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCTTGATGGAGCCATGC -3'
(R):5'- GGAGCAAAATTGGTACCTTTTGAC -3'

Sequencing Primer
(F):5'- ATGCCAGCATGTCTCCCAC -3'
(R):5'- GGTACCTTTTGACTGAATTTTCAACG -3'
Posted On2019-06-26