Incidental Mutation 'R7299:Cnga1'
ID566850
Institutional Source Beutler Lab
Gene Symbol Cnga1
Ensembl Gene ENSMUSG00000067220
Gene Namecyclic nucleotide gated channel alpha 1
SynonymsCncg
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R7299 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location72603696-72644275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72605432 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 246 (I246M)
Ref Sequence ENSEMBL: ENSMUSP00000084464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]
Predicted Effect probably benign
Transcript: ENSMUST00000087213
AA Change: I246M

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: I246M

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169997
AA Change: I246M

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: I246M

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 194 388 4.7e-19 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201463
AA Change: I246M

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: I246M

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
Armc4 T C 18: 7,222,635 K545E probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnot7 A G 8: 40,507,545 I74T probably damaging Het
Cog6 T C 3: 53,002,507 S275G probably benign Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gata4 T A 14: 63,203,742 T276S probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Cnga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Cnga1 APN 5 72604486 missense probably damaging 1.00
IGL02345:Cnga1 APN 5 72605272 missense probably benign 0.00
IGL02354:Cnga1 APN 5 72616718 splice site probably null
IGL02361:Cnga1 APN 5 72616718 splice site probably null
IGL03025:Cnga1 APN 5 72605413 missense probably benign
IGL03257:Cnga1 APN 5 72610862 missense probably damaging 1.00
IGL03046:Cnga1 UTSW 5 72604338 missense probably benign 0.01
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0352:Cnga1 UTSW 5 72604503 missense possibly damaging 0.95
R1292:Cnga1 UTSW 5 72604683 missense probably damaging 1.00
R1386:Cnga1 UTSW 5 72612183 nonsense probably null
R1903:Cnga1 UTSW 5 72616725 missense possibly damaging 0.94
R2096:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2097:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2101:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2276:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2279:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2507:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2508:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R3005:Cnga1 UTSW 5 72605107 missense probably damaging 1.00
R3779:Cnga1 UTSW 5 72604783 missense probably damaging 1.00
R4357:Cnga1 UTSW 5 72618252 missense probably damaging 1.00
R4399:Cnga1 UTSW 5 72604381 missense probably damaging 0.98
R4615:Cnga1 UTSW 5 72604774 missense probably damaging 1.00
R4946:Cnga1 UTSW 5 72604764 missense probably damaging 1.00
R5229:Cnga1 UTSW 5 72609500 missense probably damaging 1.00
R5474:Cnga1 UTSW 5 72605193 missense probably damaging 1.00
R5566:Cnga1 UTSW 5 72618250 missense probably damaging 0.98
R5754:Cnga1 UTSW 5 72605272 missense probably benign 0.00
R5899:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R5906:Cnga1 UTSW 5 72610858 missense probably benign 0.19
R5954:Cnga1 UTSW 5 72604878 missense probably damaging 0.99
R5997:Cnga1 UTSW 5 72604575 missense probably damaging 0.98
R6087:Cnga1 UTSW 5 72610812 missense probably damaging 1.00
R6365:Cnga1 UTSW 5 72604945 missense probably benign 0.00
R6391:Cnga1 UTSW 5 72612359 critical splice donor site probably null
R6525:Cnga1 UTSW 5 72618231 missense probably damaging 1.00
R7046:Cnga1 UTSW 5 72629353 intron probably benign
R7229:Cnga1 UTSW 5 72618249 missense probably benign
R7367:Cnga1 UTSW 5 72605358 missense possibly damaging 0.75
R7425:Cnga1 UTSW 5 72609525 missense probably benign 0.12
R7449:Cnga1 UTSW 5 72605304 missense probably benign 0.29
R7538:Cnga1 UTSW 5 72612380 missense not run
X0062:Cnga1 UTSW 5 72604485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATGATGATGACGATGTACATC -3'
(R):5'- TGGGATATTGTATCACTGCAGAC -3'

Sequencing Primer
(F):5'- CGATGTACATCACAAGGTTCG -3'
(R):5'- TGATTTTGGCCTAAACAAAGCTG -3'
Posted On2019-06-26