Incidental Mutation 'R7302:Zfp13'
ID567067
Institutional Source Beutler Lab
Gene Symbol Zfp13
Ensembl Gene ENSMUSG00000062012
Gene Namezinc finger protein 13
SynonymsZfp-13, Krox-8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7302 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23575844-23599487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23581062 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 89 (G89D)
Ref Sequence ENSEMBL: ENSMUSP00000111178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057029] [ENSMUST00000115516] [ENSMUST00000227952]
Predicted Effect probably benign
Transcript: ENSMUST00000057029
SMART Domains Protein: ENSMUSP00000054595
Gene: ENSMUSG00000062012

DomainStartEndE-ValueType
KRAB 117 179 7.54e-10 SMART
ZnF_C2H2 259 281 7.37e-4 SMART
ZnF_C2H2 287 309 1.2e-3 SMART
ZnF_C2H2 315 337 5.9e-3 SMART
ZnF_C2H2 343 365 1.26e-2 SMART
ZnF_C2H2 371 393 9.73e-4 SMART
ZnF_C2H2 399 421 2.12e-4 SMART
ZnF_C2H2 427 449 1.18e-2 SMART
ZnF_C2H2 455 477 6.52e-5 SMART
low complexity region 480 503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115516
AA Change: G89D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111178
Gene: ENSMUSG00000062012
AA Change: G89D

DomainStartEndE-ValueType
KRAB 124 186 7.54e-10 SMART
ZnF_C2H2 266 288 7.37e-4 SMART
ZnF_C2H2 294 316 1.2e-3 SMART
ZnF_C2H2 322 344 5.9e-3 SMART
ZnF_C2H2 350 372 1.26e-2 SMART
ZnF_C2H2 378 400 9.73e-4 SMART
ZnF_C2H2 406 428 2.12e-4 SMART
ZnF_C2H2 434 456 1.18e-2 SMART
ZnF_C2H2 462 484 6.52e-5 SMART
low complexity region 487 510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227952
AA Change: G74D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,349 P69S probably benign Het
Adam17 A G 12: 21,355,693 probably benign Het
AI314180 T C 4: 58,834,593 K762E probably benign Het
Bcl7a T A 5: 123,344,694 M22K probably benign Het
C6 T A 15: 4,796,950 C672S probably damaging Het
Capn11 C T 17: 45,643,812 R133H probably damaging Het
Ccdc102a A G 8: 94,913,438 L76P probably damaging Het
Cotl1 T G 8: 119,810,301 I125L probably benign Het
Dennd5a A T 7: 109,905,699 M868K probably damaging Het
Depdc5 T C 5: 32,979,508 I1374T probably damaging Het
Dhx36 T C 3: 62,479,393 Y646C probably benign Het
Egln2 A G 7: 27,164,885 V205A probably damaging Het
Eri2 T A 7: 119,786,786 M229L probably benign Het
Fancf C A 7: 51,861,704 R184L probably damaging Het
Fancl A T 11: 26,403,363 E86D probably damaging Het
Fignl2 T C 15: 101,053,378 D341G unknown Het
Gm14410 A T 2: 177,193,855 H205Q probably damaging Het
Gm4788 T C 1: 139,739,698 probably null Het
Haus1 T C 18: 77,760,966 N181D probably benign Het
Hmbox1 T C 14: 64,828,666 Y285C probably damaging Het
Igkv3-9 A G 6: 70,588,755 M113V probably benign Het
Ivd T C 2: 118,871,504 V139A probably benign Het
Limch1 A T 5: 66,959,599 Y119F probably benign Het
Lrp1 C T 10: 127,538,987 R4534Q probably benign Het
Mbd3l2 G A 9: 18,444,442 S21N probably benign Het
Mob1b A G 5: 88,753,177 N148D probably benign Het
Mylk4 A T 13: 32,720,565 D195E probably benign Het
Ndufa7 T C 17: 33,829,713 S50P probably benign Het
Nectin4 G T 1: 171,386,635 E453* probably null Het
Nell1 T G 7: 50,856,269 F741L probably benign Het
Ntng1 T A 3: 109,832,617 H369L possibly damaging Het
Plin4 T A 17: 56,102,330 M1297L probably benign Het
Pnp G A 14: 50,950,947 V193M probably damaging Het
Ppp1r10 T G 17: 35,930,881 S849R unknown Het
Rpgrip1 A G 14: 52,149,555 E981G unknown Het
Sbsn T C 7: 30,751,884 F108S probably benign Het
Scn11a A G 9: 119,806,951 M310T probably benign Het
Sf3b1 A G 1: 55,016,790 S97P probably benign Het
Sgsh A G 11: 119,347,699 V313A probably benign Het
Slc25a10 G T 11: 120,491,956 probably benign Het
Slc9a2 T A 1: 40,767,668 V705E possibly damaging Het
Surf2 G T 2: 26,918,882 C116F probably damaging Het
Tnks1bp1 T C 2: 85,052,354 I175T probably benign Het
Tnxb C T 17: 34,678,901 T841I probably benign Het
Ttll3 A G 6: 113,409,285 D693G probably damaging Het
Ust A G 10: 8,518,209 L64P probably damaging Het
Vmn1r77 C T 7: 12,042,056 S253F possibly damaging Het
Vmn2r66 A G 7: 85,005,215 M512T probably benign Het
Zfp616 T A 11: 74,085,379 Y825N probably benign Het
Zfp865 A G 7: 5,029,253 Y79C possibly damaging Het
Zfyve26 A T 12: 79,251,168 F1916I probably damaging Het
Other mutations in Zfp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02236:Zfp13 APN 17 23580765 splice site probably benign
IGL02447:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02449:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02450:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02466:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02468:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02471:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02473:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02474:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02475:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02491:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02511:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02558:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL03030:Zfp13 APN 17 23580845 missense probably benign 0.01
IGL03388:Zfp13 APN 17 23576914 missense probably benign 0.00
R0053:Zfp13 UTSW 17 23576148 missense probably damaging 1.00
R0053:Zfp13 UTSW 17 23576148 missense probably damaging 1.00
R1514:Zfp13 UTSW 17 23576412 missense probably damaging 1.00
R2420:Zfp13 UTSW 17 23576212 missense probably damaging 1.00
R3433:Zfp13 UTSW 17 23576628 missense probably damaging 0.99
R4458:Zfp13 UTSW 17 23581176 missense probably benign 0.01
R4650:Zfp13 UTSW 17 23580138 missense probably damaging 1.00
R4824:Zfp13 UTSW 17 23576823 missense possibly damaging 0.95
R5088:Zfp13 UTSW 17 23577061 nonsense probably null
R5110:Zfp13 UTSW 17 23580860 missense probably benign 0.02
R5384:Zfp13 UTSW 17 23581182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGGAAGACAGGGTCCTC -3'
(R):5'- GTAATGTGCAACACTGTGGAGAC -3'

Sequencing Primer
(F):5'- ACAGGGTCCTCAGAGCAG -3'
(R):5'- AACACTGTGGAGACATGCTCTCTG -3'
Posted On2019-06-26