Incidental Mutation 'R7303:Olfr1087'
ID567080
Institutional Source Beutler Lab
Gene Symbol Olfr1087
Ensembl Gene ENSMUSG00000075174
Gene Nameolfactory receptor 1087
SynonymsGA_x6K02T2Q125-48182406-48181465, MOR188-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7303 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86687235-86698395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86690822 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 51 (V51A)
Ref Sequence ENSEMBL: ENSMUSP00000149439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099877] [ENSMUST00000214141]
Predicted Effect probably benign
Transcript: ENSMUST00000099877
AA Change: V51A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097462
Gene: ENSMUSG00000075174
AA Change: V51A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.5e-49 PFAM
Pfam:7tm_1 41 290 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214141
AA Change: V51A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik G C 8: 84,161,233 G71A probably benign Het
Abca3 T G 17: 24,398,521 L1064R possibly damaging Het
Abca7 A T 10: 80,014,988 D2051V probably benign Het
Abcb5 T A 12: 118,911,560 I626F probably damaging Het
Abcg5 A G 17: 84,670,346 S333P probably damaging Het
Abl2 T C 1: 156,641,250 S695P probably benign Het
Aen C T 7: 78,902,456 P55S possibly damaging Het
Afg3l1 G T 8: 123,501,269 A598S probably damaging Het
Aldh16a1 A T 7: 45,147,904 L160Q probably damaging Het
Ang A T 14: 51,101,516 H38L probably benign Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Aox2 A T 1: 58,334,765 K862* probably null Het
Cad T C 5: 31,060,213 probably null Het
Cc2d2b A T 19: 40,808,994 Y740F unknown Het
Ccdc182 T C 11: 88,294,216 Y41H probably benign Het
Chd9 A G 8: 91,051,904 R2848G unknown Het
Chrna6 A T 8: 27,406,991 L286* probably null Het
Cracr2b A G 7: 141,463,202 probably benign Het
Fam184b C T 5: 45,542,226 probably null Het
Fam208a A G 14: 27,471,852 E1003G probably damaging Het
Flnc T C 6: 29,460,850 S2647P probably benign Het
Ftsj3 T C 11: 106,254,680 D76G probably damaging Het
Fxyd1 T A 7: 31,054,318 M17L probably benign Het
Golim4 G A 3: 75,878,053 S677L probably damaging Het
Gpr149 A G 3: 62,595,070 V455A possibly damaging Het
H2-Q1 C A 17: 35,321,336 S132R probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Herc1 A T 9: 66,450,816 D2393V possibly damaging Het
Hmgb2 A G 8: 57,512,728 K44E possibly damaging Het
Itgad A G 7: 128,190,179 D605G probably benign Het
Kbtbd12 G T 6: 88,614,112 F16L unknown Het
Klhl23 T C 2: 69,824,701 I305T probably benign Het
Lrguk A T 6: 34,029,476 N7I probably benign Het
Lrp5 A G 19: 3,591,774 L1396P probably damaging Het
Mapkapk5 T C 5: 121,540,574 E13G probably benign Het
Mark3 T C 12: 111,655,536 V704A probably damaging Het
Mast2 A G 4: 116,308,311 S1303P possibly damaging Het
Mcm2 T C 6: 88,887,946 D516G probably damaging Het
Mon2 A T 10: 123,038,459 probably null Het
Mrc2 T A 11: 105,325,803 N139K probably damaging Het
Myh14 C T 7: 44,611,701 E1789K probably damaging Het
Myh7b T A 2: 155,618,740 L271Q probably damaging Het
Odf3l2 G A 10: 79,642,691 P80S probably benign Het
Olfr61 T C 7: 140,638,354 S218P probably damaging Het
Oog2 A T 4: 144,195,342 H274L probably benign Het
Oosp1 A C 19: 11,668,410 S121R probably benign Het
Pepd T C 7: 35,021,772 probably null Het
Pik3c2a A C 7: 116,405,943 S363R probably benign Het
Polr2b T C 5: 77,321,021 Y215H probably benign Het
Ppcdc A T 9: 57,414,675 V194E probably benign Het
Rabgap1l A C 1: 160,682,097 I470S probably benign Het
Scgb1b3 G A 7: 31,375,958 A78T probably benign Het
Slc9a5 T A 8: 105,356,713 L368Q probably damaging Het
Spef2 T A 15: 9,647,490 I944F possibly damaging Het
Syne1 T A 10: 5,256,805 H3461L probably benign Het
Tas2r134 A G 2: 51,628,133 Y208C probably benign Het
Tm9sf3 G A 19: 41,238,759 S291F probably damaging Het
Tra2a G A 6: 49,250,987 T69I unknown Het
Ube2q1 T A 3: 89,776,591 L171Q possibly damaging Het
Ufd1 A G 16: 18,817,965 T78A probably damaging Het
Vmn1r13 T C 6: 57,210,602 S249P probably damaging Het
Wdr91 G A 6: 34,884,323 S648L probably benign Het
Zfp51 T A 17: 21,463,796 N224K probably benign Het
Other mutations in Olfr1087
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Olfr1087 APN 2 86690701 missense possibly damaging 0.90
IGL02300:Olfr1087 APN 2 86690652 missense probably benign 0.43
IGL03259:Olfr1087 APN 2 86690550 missense probably benign 0.00
IGL03404:Olfr1087 APN 2 86690028 utr 3 prime probably benign
R1430:Olfr1087 UTSW 2 86690522 missense possibly damaging 0.91
R1513:Olfr1087 UTSW 2 86690797 missense possibly damaging 0.60
R1529:Olfr1087 UTSW 2 86690333 missense possibly damaging 0.69
R1767:Olfr1087 UTSW 2 86690384 missense probably benign 0.01
R1869:Olfr1087 UTSW 2 86690391 missense probably damaging 0.98
R3056:Olfr1087 UTSW 2 86690552 missense possibly damaging 0.91
R5002:Olfr1087 UTSW 2 86690085 missense possibly damaging 0.95
X0063:Olfr1087 UTSW 2 86690543 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCATAGGACATTGCAGACAG -3'
(R):5'- ATCACATGTTGGGTATTTGCTC -3'

Sequencing Primer
(F):5'- TTGCAGACAGAATCAAAAGCTC -3'
(R):5'- TGCTCTTTGATGTTACTGTAATGTAC -3'
Posted On2019-06-26