Incidental Mutation 'R7303:Mapkapk5'
ID567090
Institutional Source Beutler Lab
Gene Symbol Mapkapk5
Ensembl Gene ENSMUSG00000029454
Gene NameMAP kinase-activated protein kinase 5
SynonymsPRAK, MK5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7303 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location121525038-121545905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121540574 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 13 (E13G)
Ref Sequence ENSEMBL: ENSMUSP00000031410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031410] [ENSMUST00000111782] [ENSMUST00000111783] [ENSMUST00000111786] [ENSMUST00000125946] [ENSMUST00000196315] [ENSMUST00000200170]
Predicted Effect probably benign
Transcript: ENSMUST00000031410
AA Change: E13G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031410
Gene: ENSMUSG00000029454
AA Change: E13G

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 409 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111782
SMART Domains Protein: ENSMUSP00000107412
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.7e-27 PFAM
coiled coil region 258 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111783
AA Change: E13G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107413
Gene: ENSMUSG00000029454
AA Change: E13G

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111786
SMART Domains Protein: ENSMUSP00000107416
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.8e-27 PFAM
coiled coil region 260 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125946
AA Change: E13G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340
AA Change: E13G

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151352
Predicted Effect probably benign
Transcript: ENSMUST00000196315
AA Change: E13G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142346
Gene: ENSMUSG00000029454
AA Change: E13G

DomainStartEndE-ValueType
STYKc 22 179 4.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200170
AA Change: E13G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647
AA Change: E13G

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutant mice are viable, fertile, and show no overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik G C 8: 84,161,233 G71A probably benign Het
Abca3 T G 17: 24,398,521 L1064R possibly damaging Het
Abca7 A T 10: 80,014,988 D2051V probably benign Het
Abcb5 T A 12: 118,911,560 I626F probably damaging Het
Abcg5 A G 17: 84,670,346 S333P probably damaging Het
Abl2 T C 1: 156,641,250 S695P probably benign Het
Aen C T 7: 78,902,456 P55S possibly damaging Het
Afg3l1 G T 8: 123,501,269 A598S probably damaging Het
Aldh16a1 A T 7: 45,147,904 L160Q probably damaging Het
Ang A T 14: 51,101,516 H38L probably benign Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Aox2 A T 1: 58,334,765 K862* probably null Het
Cad T C 5: 31,060,213 probably null Het
Cc2d2b A T 19: 40,808,994 Y740F unknown Het
Ccdc182 T C 11: 88,294,216 Y41H probably benign Het
Chd9 A G 8: 91,051,904 R2848G unknown Het
Chrna6 A T 8: 27,406,991 L286* probably null Het
Cracr2b A G 7: 141,463,202 probably benign Het
Fam184b C T 5: 45,542,226 probably null Het
Fam208a A G 14: 27,471,852 E1003G probably damaging Het
Flnc T C 6: 29,460,850 S2647P probably benign Het
Ftsj3 T C 11: 106,254,680 D76G probably damaging Het
Fxyd1 T A 7: 31,054,318 M17L probably benign Het
Golim4 G A 3: 75,878,053 S677L probably damaging Het
Gpr149 A G 3: 62,595,070 V455A possibly damaging Het
H2-Q1 C A 17: 35,321,336 S132R probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Herc1 A T 9: 66,450,816 D2393V possibly damaging Het
Hmgb2 A G 8: 57,512,728 K44E possibly damaging Het
Itgad A G 7: 128,190,179 D605G probably benign Het
Kbtbd12 G T 6: 88,614,112 F16L unknown Het
Klhl23 T C 2: 69,824,701 I305T probably benign Het
Lrguk A T 6: 34,029,476 N7I probably benign Het
Lrp5 A G 19: 3,591,774 L1396P probably damaging Het
Mark3 T C 12: 111,655,536 V704A probably damaging Het
Mast2 A G 4: 116,308,311 S1303P possibly damaging Het
Mcm2 T C 6: 88,887,946 D516G probably damaging Het
Mon2 A T 10: 123,038,459 probably null Het
Mrc2 T A 11: 105,325,803 N139K probably damaging Het
Myh14 C T 7: 44,611,701 E1789K probably damaging Het
Myh7b T A 2: 155,618,740 L271Q probably damaging Het
Odf3l2 G A 10: 79,642,691 P80S probably benign Het
Olfr1087 A G 2: 86,690,822 V51A probably benign Het
Olfr61 T C 7: 140,638,354 S218P probably damaging Het
Oog2 A T 4: 144,195,342 H274L probably benign Het
Oosp1 A C 19: 11,668,410 S121R probably benign Het
Pepd T C 7: 35,021,772 probably null Het
Pik3c2a A C 7: 116,405,943 S363R probably benign Het
Polr2b T C 5: 77,321,021 Y215H probably benign Het
Ppcdc A T 9: 57,414,675 V194E probably benign Het
Rabgap1l A C 1: 160,682,097 I470S probably benign Het
Scgb1b3 G A 7: 31,375,958 A78T probably benign Het
Slc9a5 T A 8: 105,356,713 L368Q probably damaging Het
Spef2 T A 15: 9,647,490 I944F possibly damaging Het
Syne1 T A 10: 5,256,805 H3461L probably benign Het
Tas2r134 A G 2: 51,628,133 Y208C probably benign Het
Tm9sf3 G A 19: 41,238,759 S291F probably damaging Het
Tra2a G A 6: 49,250,987 T69I unknown Het
Ube2q1 T A 3: 89,776,591 L171Q possibly damaging Het
Ufd1 A G 16: 18,817,965 T78A probably damaging Het
Vmn1r13 T C 6: 57,210,602 S249P probably damaging Het
Wdr91 G A 6: 34,884,323 S648L probably benign Het
Zfp51 T A 17: 21,463,796 N224K probably benign Het
Other mutations in Mapkapk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mapkapk5 APN 5 121537103 splice site probably benign
R1015:Mapkapk5 UTSW 5 121533362 missense probably benign 0.17
R2180:Mapkapk5 UTSW 5 121535864 intron probably null
R4445:Mapkapk5 UTSW 5 121525228 missense probably benign
R4539:Mapkapk5 UTSW 5 121537155 missense possibly damaging 0.82
R5217:Mapkapk5 UTSW 5 121534429 missense probably damaging 1.00
R5229:Mapkapk5 UTSW 5 121533391 critical splice acceptor site probably null
R5422:Mapkapk5 UTSW 5 121531722 critical splice acceptor site probably null
R5963:Mapkapk5 UTSW 5 121538481 missense probably damaging 1.00
R6378:Mapkapk5 UTSW 5 121539170 critical splice donor site probably null
R7021:Mapkapk5 UTSW 5 121527211 missense probably benign 0.02
Z1088:Mapkapk5 UTSW 5 121531591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TAAACTCAGGCCAATTCTTAGGGC -3'
(R):5'- GGCGGGTAACTTATCCAGTTTC -3'

Sequencing Primer
(F):5'- GCCAATTCTTAGGGCGCATC -3'
(R):5'- ATTCTCGAACCTATGTTATTGGGAG -3'
Posted On2019-06-26