Incidental Mutation 'R7303:Spef2'
ID567127
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7303 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9647490 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 944 (I944F)
Ref Sequence ENSEMBL: ENSMUSP00000146967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160236
AA Change: I944F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: I944F

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: I944F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik G C 8: 84,161,233 G71A probably benign Het
Abca3 T G 17: 24,398,521 L1064R possibly damaging Het
Abca7 A T 10: 80,014,988 D2051V probably benign Het
Abcb5 T A 12: 118,911,560 I626F probably damaging Het
Abcg5 A G 17: 84,670,346 S333P probably damaging Het
Abl2 T C 1: 156,641,250 S695P probably benign Het
Aen C T 7: 78,902,456 P55S possibly damaging Het
Afg3l1 G T 8: 123,501,269 A598S probably damaging Het
Aldh16a1 A T 7: 45,147,904 L160Q probably damaging Het
Ang A T 14: 51,101,516 H38L probably benign Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Aox2 A T 1: 58,334,765 K862* probably null Het
Cad T C 5: 31,060,213 probably null Het
Cc2d2b A T 19: 40,808,994 Y740F unknown Het
Ccdc182 T C 11: 88,294,216 Y41H probably benign Het
Chd9 A G 8: 91,051,904 R2848G unknown Het
Chrna6 A T 8: 27,406,991 L286* probably null Het
Cracr2b A G 7: 141,463,202 probably benign Het
Fam184b C T 5: 45,542,226 probably null Het
Fam208a A G 14: 27,471,852 E1003G probably damaging Het
Flnc T C 6: 29,460,850 S2647P probably benign Het
Ftsj3 T C 11: 106,254,680 D76G probably damaging Het
Fxyd1 T A 7: 31,054,318 M17L probably benign Het
Golim4 G A 3: 75,878,053 S677L probably damaging Het
Gpr149 A G 3: 62,595,070 V455A possibly damaging Het
H2-Q1 C A 17: 35,321,336 S132R probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Herc1 A T 9: 66,450,816 D2393V possibly damaging Het
Hmgb2 A G 8: 57,512,728 K44E possibly damaging Het
Itgad A G 7: 128,190,179 D605G probably benign Het
Kbtbd12 G T 6: 88,614,112 F16L unknown Het
Klhl23 T C 2: 69,824,701 I305T probably benign Het
Lrguk A T 6: 34,029,476 N7I probably benign Het
Lrp5 A G 19: 3,591,774 L1396P probably damaging Het
Mapkapk5 T C 5: 121,540,574 E13G probably benign Het
Mark3 T C 12: 111,655,536 V704A probably damaging Het
Mast2 A G 4: 116,308,311 S1303P possibly damaging Het
Mcm2 T C 6: 88,887,946 D516G probably damaging Het
Mon2 A T 10: 123,038,459 probably null Het
Mrc2 T A 11: 105,325,803 N139K probably damaging Het
Myh14 C T 7: 44,611,701 E1789K probably damaging Het
Myh7b T A 2: 155,618,740 L271Q probably damaging Het
Odf3l2 G A 10: 79,642,691 P80S probably benign Het
Olfr1087 A G 2: 86,690,822 V51A probably benign Het
Olfr61 T C 7: 140,638,354 S218P probably damaging Het
Oog2 A T 4: 144,195,342 H274L probably benign Het
Oosp1 A C 19: 11,668,410 S121R probably benign Het
Pepd T C 7: 35,021,772 probably null Het
Pik3c2a A C 7: 116,405,943 S363R probably benign Het
Polr2b T C 5: 77,321,021 Y215H probably benign Het
Ppcdc A T 9: 57,414,675 V194E probably benign Het
Rabgap1l A C 1: 160,682,097 I470S probably benign Het
Scgb1b3 G A 7: 31,375,958 A78T probably benign Het
Slc9a5 T A 8: 105,356,713 L368Q probably damaging Het
Syne1 T A 10: 5,256,805 H3461L probably benign Het
Tas2r134 A G 2: 51,628,133 Y208C probably benign Het
Tm9sf3 G A 19: 41,238,759 S291F probably damaging Het
Tra2a G A 6: 49,250,987 T69I unknown Het
Ube2q1 T A 3: 89,776,591 L171Q possibly damaging Het
Ufd1 A G 16: 18,817,965 T78A probably damaging Het
Vmn1r13 T C 6: 57,210,602 S249P probably damaging Het
Wdr91 G A 6: 34,884,323 S648L probably benign Het
Zfp51 T A 17: 21,463,796 N224K probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGCCTGCCACTGAGATAC -3'
(R):5'- ACATCCTATAAGCTGTGCTCCAG -3'

Sequencing Primer
(F):5'- TGATCTGGACGCCGTAGAAACTC -3'
(R):5'- CCAGGTAGTGGCAGTTGGGAC -3'
Posted On2019-06-26