Incidental Mutation 'R7305:Etl4'
ID567209
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Nameenhancer trap locus 4
Synonyms6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R7305 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location19909780-20810713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20709557 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000110257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: I236F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: I236F

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: I236F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: I236F

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: I236F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: I236F

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114610
AA Change: I156F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: I156F

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: I236F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: I236F

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: I287F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: I287F

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,119 I4019K probably benign Het
9130011E15Rik A T 19: 45,892,121 M508K probably benign Het
Abhd16b A T 2: 181,493,416 D37V possibly damaging Het
Ankhd1 A G 18: 36,632,205 D87G Het
Ankrd31 A G 13: 96,878,971 S1583G probably damaging Het
Ankub1 T C 3: 57,692,517 probably benign Het
Apba3 A G 10: 81,271,233 D264G probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cnot3 A T 7: 3,645,480 probably benign Het
Cxxc1 A G 18: 74,219,396 Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp3a57 A G 5: 145,370,985 I184V probably benign Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,623,355 probably null Het
Dab1 T A 4: 104,713,790 D210E Het
Elavl1 G A 8: 4,325,199 probably benign Het
Emilin1 C T 5: 30,917,089 Q225* probably null Het
Eml6 G T 11: 29,777,258 A1288E probably benign Het
Eno1 T C 4: 150,245,339 probably null Het
Eprs C T 1: 185,379,701 R303C probably damaging Het
Eps15l1 G A 8: 72,373,034 A651V probably benign Het
Faim2 A T 15: 99,513,933 I171N probably damaging Het
Fam105a A G 15: 27,658,233 C184R probably benign Het
Fam135a T A 1: 24,030,858 N381I probably damaging Het
Fam160a1 G T 3: 85,730,524 P156Q probably damaging Het
Fam71d A G 12: 78,715,035 K158E possibly damaging Het
Gabrg3 T A 7: 56,735,085 M243L probably benign Het
Gm5134 A G 10: 76,000,399 I405V probably damaging Het
Gm6614 G A 6: 141,992,494 A253V probably damaging Het
Gm9376 A T 14: 118,267,356 K67* probably null Het
Grm8 A T 6: 27,761,355 I290K possibly damaging Het
Hao1 T A 2: 134,548,201 M73L probably benign Het
Herc1 A G 9: 66,461,868 D452G Het
Idh3b C A 2: 130,281,493 K192N possibly damaging Het
Igkv6-23 A G 6: 70,260,569 S63P probably benign Het
Itgb2 A C 10: 77,548,564 D173A probably damaging Het
Jmjd8 A T 17: 25,830,327 T255S probably benign Het
Lamc3 A C 2: 31,930,702 E1243A probably benign Het
Map1a A G 2: 121,299,458 T252A probably damaging Het
Mrgpra1 C A 7: 47,335,455 A159S probably benign Het
Ndst3 T C 3: 123,601,482 I500V possibly damaging Het
Nhsl1 A G 10: 18,531,686 T1523A possibly damaging Het
Nr2f1 A G 13: 78,195,179 I322T probably damaging Het
Nup210 T C 6: 91,087,966 E184G probably damaging Het
Obsl1 C T 1: 75,493,946 W1022* probably null Het
Olfr1250 T A 2: 89,656,502 H313L probably benign Het
Olfr166 T A 16: 19,487,699 I287N probably damaging Het
Olfr470 A T 7: 107,845,365 Y123N probably damaging Het
Olfr551 G T 7: 102,587,955 Q263K possibly damaging Het
Olfr802 A T 10: 129,682,280 I153N probably damaging Het
Olfr808 T A 10: 129,767,851 Y118* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Parp8 A G 13: 116,894,925 L417P possibly damaging Het
Pdia6 A G 12: 17,274,508 Q120R probably benign Het
Ppp3cc T C 14: 70,240,803 N290S probably benign Het
Prdm5 C A 6: 65,831,260 S63R possibly damaging Het
Prr14l T C 5: 32,831,101 D350G probably benign Het
Pwwp2a T C 11: 43,717,051 L497S probably damaging Het
R3hdm2 A G 10: 127,476,678 N430D probably benign Het
Rad51ap2 A G 12: 11,457,343 N422S possibly damaging Het
Rbbp8 G A 18: 11,672,581 probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,918 probably benign Het
Slc22a6 G A 19: 8,622,158 probably null Het
Slc28a3 T A 13: 58,566,231 E440V possibly damaging Het
Slc30a5 A T 13: 100,811,424 I482K probably damaging Het
Slco1a1 A T 6: 141,924,497 F305Y probably damaging Het
Slco4c1 T C 1: 96,828,965 N544S probably damaging Het
Smpd4 T A 16: 17,641,783 I656N probably damaging Het
Taok1 A T 11: 77,541,674 L771* probably null Het
Tmem231 T C 8: 111,915,295 D209G possibly damaging Het
Tmem25 A G 9: 44,795,408 probably null Het
Tmem79 T C 3: 88,333,411 T77A probably benign Het
Topbp1 A T 9: 103,328,637 T825S probably damaging Het
Trpm6 A T 19: 18,876,091 Q1825L probably benign Het
Uba1y T A Y: 821,348 D110E probably damaging Het
Utrn A T 10: 12,385,536 N3422K probably benign Het
Vmn1r219 A T 13: 23,163,144 M168L probably benign Het
Vmn2r62 T C 7: 42,764,811 H736R possibly damaging Het
Wdr1 T C 5: 38,540,092 H291R possibly damaging Het
Zan T C 5: 137,415,139 T3177A unknown Het
Zbtb21 T C 16: 97,951,295 H596R possibly damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20766478 missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20530054 missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20806531 nonsense probably null
IGL01099:Etl4 APN 2 20807111 missense probably benign 0.06
IGL01337:Etl4 APN 2 20785387 missense probably benign 0.01
IGL01348:Etl4 APN 2 20806973 missense probably damaging 1.00
IGL01349:Etl4 APN 2 20713396 missense probably damaging 1.00
IGL01407:Etl4 APN 2 20743856 missense probably damaging 0.99
IGL01552:Etl4 APN 2 20778189 missense probably damaging 0.99
IGL01662:Etl4 APN 2 20806649 missense probably benign 0.04
IGL01687:Etl4 APN 2 20530087 missense probably damaging 1.00
IGL01793:Etl4 APN 2 20743898 missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20806682 missense probably benign 0.06
IGL02025:Etl4 APN 2 20806526 missense probably damaging 1.00
IGL02088:Etl4 APN 2 20806548 missense probably damaging 1.00
IGL02134:Etl4 APN 2 20806429 missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20530189 missense probably damaging 1.00
IGL02480:Etl4 APN 2 20788524 missense probably damaging 0.99
IGL02560:Etl4 APN 2 20743718 missense probably damaging 1.00
IGL02851:Etl4 APN 2 20808029 missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20760210 splice site probably benign
IGL02951:Etl4 APN 2 20801537 splice site probably benign
IGL03119:Etl4 APN 2 20713387 missense probably damaging 1.00
IGL03267:Etl4 APN 2 20785182 nonsense probably null
IGL03379:Etl4 APN 2 20662016 missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0095:Etl4 UTSW 2 20743868 missense probably damaging 1.00
R0100:Etl4 UTSW 2 20339905 missense probably benign
R0311:Etl4 UTSW 2 20807129 missense probably damaging 1.00
R0346:Etl4 UTSW 2 20759652 critical splice donor site probably null
R0348:Etl4 UTSW 2 20778129 missense probably damaging 1.00
R0379:Etl4 UTSW 2 20807354 missense probably damaging 0.98
R0571:Etl4 UTSW 2 20743769 missense probably damaging 0.99
R0697:Etl4 UTSW 2 20743861 missense probably damaging 1.00
R0707:Etl4 UTSW 2 20805571 splice site probably benign
R0980:Etl4 UTSW 2 20801567 missense probably damaging 1.00
R1120:Etl4 UTSW 2 20806703 missense probably benign 0.00
R1254:Etl4 UTSW 2 20807923 missense probably damaging 1.00
R1346:Etl4 UTSW 2 20806144 missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20788477 missense probably damaging 1.00
R1503:Etl4 UTSW 2 20743874 missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R1627:Etl4 UTSW 2 20801579 missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20806408 missense probably damaging 1.00
R1716:Etl4 UTSW 2 20743681 missense probably damaging 1.00
R1795:Etl4 UTSW 2 20808026 critical splice donor site probably null
R1885:Etl4 UTSW 2 20743984 missense probably damaging 1.00
R2039:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R2083:Etl4 UTSW 2 20743549 missense probably damaging 1.00
R2109:Etl4 UTSW 2 20785342 missense probably benign 0.27
R2153:Etl4 UTSW 2 20798734 missense probably benign 0.00
R2403:Etl4 UTSW 2 20807306 nonsense probably null
R2883:Etl4 UTSW 2 20806174 missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20781849 missense probably damaging 1.00
R3402:Etl4 UTSW 2 20781882 missense probably damaging 1.00
R3696:Etl4 UTSW 2 20801662 critical splice donor site probably null
R3755:Etl4 UTSW 2 20743537 missense probably benign 0.10
R3813:Etl4 UTSW 2 20788435 missense probably damaging 1.00
R3829:Etl4 UTSW 2 20785421 missense probably benign 0.07
R3887:Etl4 UTSW 2 20529961 nonsense probably null
R3888:Etl4 UTSW 2 20529961 nonsense probably null
R3889:Etl4 UTSW 2 20529961 nonsense probably null
R3958:Etl4 UTSW 2 20340043 missense probably benign
R3959:Etl4 UTSW 2 20340043 missense probably benign
R3960:Etl4 UTSW 2 20340043 missense probably benign
R4058:Etl4 UTSW 2 20806019 missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20809219 utr 3 prime probably benign
R4077:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4078:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4127:Etl4 UTSW 2 20744075 missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20781883 missense probably damaging 1.00
R4492:Etl4 UTSW 2 20806865 missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20661898 missense probably damaging 1.00
R4820:Etl4 UTSW 2 20806685 missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20806927 missense probably damaging 1.00
R4888:Etl4 UTSW 2 20340111 critical splice donor site probably null
R4938:Etl4 UTSW 2 20798649 missense probably benign 0.00
R4943:Etl4 UTSW 2 20807281 missense probably benign 0.05
R5121:Etl4 UTSW 2 20340111 critical splice donor site probably null
R5191:Etl4 UTSW 2 20339999 missense probably damaging 0.99
R5198:Etl4 UTSW 2 20713387 missense probably damaging 1.00
R5199:Etl4 UTSW 2 20744042 missense probably damaging 1.00
R5470:Etl4 UTSW 2 20529980 missense probably damaging 0.99
R5513:Etl4 UTSW 2 20743827 missense probably damaging 1.00
R5620:Etl4 UTSW 2 20530226 missense probably damaging 1.00
R5635:Etl4 UTSW 2 20807035 missense probably damaging 1.00
R5641:Etl4 UTSW 2 20806462 frame shift probably null
R5690:Etl4 UTSW 2 20805836 missense probably benign 0.01
R5784:Etl4 UTSW 2 20806205 missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20806512 missense probably damaging 1.00
R5908:Etl4 UTSW 2 20743907 missense probably damaging 0.96
R5982:Etl4 UTSW 2 20781015 missense probably damaging 1.00
R6151:Etl4 UTSW 2 20713360 missense probably damaging 1.00
R6192:Etl4 UTSW 2 20801551 missense probably damaging 0.98
R6238:Etl4 UTSW 2 20801568 missense probably damaging 1.00
R6248:Etl4 UTSW 2 20809089 missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20743573 missense probably damaging 1.00
R6610:Etl4 UTSW 2 20713369 missense probably damaging 1.00
R6739:Etl4 UTSW 2 20713435 missense probably damaging 1.00
R6846:Etl4 UTSW 2 20744108 missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20806309 missense probably benign 0.01
R6873:Etl4 UTSW 2 20797992 synonymous probably null
R7003:Etl4 UTSW 2 20805884 missense probably benign 0.03
R7155:Etl4 UTSW 2 20806931 missense probably damaging 0.96
R7207:Etl4 UTSW 2 20709576 missense probably damaging 0.99
R7230:Etl4 UTSW 2 20797988 missense probably damaging 1.00
X0018:Etl4 UTSW 2 20809190 missense probably damaging 0.98
X0022:Etl4 UTSW 2 20709564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTTGCATGCAGGTGTCC -3'
(R):5'- GAGCATGAATTCCCATCTGTGTG -3'

Sequencing Primer
(F):5'- GCATGCAGGTGTCCTCTAC -3'
(R):5'- AATGACTGGACTCTTGCCATCAGG -3'
Posted On2019-06-26