Incidental Mutation 'R7305:Itgb2'
ID567250
Institutional Source Beutler Lab
Gene Symbol Itgb2
Ensembl Gene ENSMUSG00000000290
Gene Nameintegrin beta 2
SynonymsMac-1 beta, Cd18, 2E6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R7305 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location77530252-77565708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77548564 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 173 (D173A)
Ref Sequence ENSEMBL: ENSMUSP00000000299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000130059] [ENSMUST00000131023] [ENSMUST00000153541] [ENSMUST00000156644]
Predicted Effect probably damaging
Transcript: ENSMUST00000000299
AA Change: D173A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290
AA Change: D173A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130059
AA Change: D95A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118191
Gene: ENSMUSG00000000290
AA Change: D95A

DomainStartEndE-ValueType
INB 1 130 2.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131023
SMART Domains Protein: ENSMUSP00000119657
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
Pfam:Integrin_beta 2 54 7.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153541
AA Change: D173A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290
AA Change: D173A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156644
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,119 I4019K probably benign Het
9130011E15Rik A T 19: 45,892,121 M508K probably benign Het
Abhd16b A T 2: 181,493,416 D37V possibly damaging Het
Ankhd1 A G 18: 36,632,205 D87G Het
Ankrd31 A G 13: 96,878,971 S1583G probably damaging Het
Ankub1 T C 3: 57,692,517 probably benign Het
Apba3 A G 10: 81,271,233 D264G probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cnot3 A T 7: 3,645,480 probably benign Het
Cxxc1 A G 18: 74,219,396 Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp3a57 A G 5: 145,370,985 I184V probably benign Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,623,355 probably null Het
Dab1 T A 4: 104,713,790 D210E Het
Elavl1 G A 8: 4,325,199 probably benign Het
Emilin1 C T 5: 30,917,089 Q225* probably null Het
Eml6 G T 11: 29,777,258 A1288E probably benign Het
Eno1 T C 4: 150,245,339 probably null Het
Eprs C T 1: 185,379,701 R303C probably damaging Het
Eps15l1 G A 8: 72,373,034 A651V probably benign Het
Etl4 A T 2: 20,709,557 I156F probably damaging Het
Faim2 A T 15: 99,513,933 I171N probably damaging Het
Fam105a A G 15: 27,658,233 C184R probably benign Het
Fam135a T A 1: 24,030,858 N381I probably damaging Het
Fam160a1 G T 3: 85,730,524 P156Q probably damaging Het
Fam71d A G 12: 78,715,035 K158E possibly damaging Het
Gabrg3 T A 7: 56,735,085 M243L probably benign Het
Gm5134 A G 10: 76,000,399 I405V probably damaging Het
Gm6614 G A 6: 141,992,494 A253V probably damaging Het
Gm9376 A T 14: 118,267,356 K67* probably null Het
Grm8 A T 6: 27,761,355 I290K possibly damaging Het
Hao1 T A 2: 134,548,201 M73L probably benign Het
Herc1 A G 9: 66,461,868 D452G Het
Idh3b C A 2: 130,281,493 K192N possibly damaging Het
Igkv6-23 A G 6: 70,260,569 S63P probably benign Het
Jmjd8 A T 17: 25,830,327 T255S probably benign Het
Lamc3 A C 2: 31,930,702 E1243A probably benign Het
Map1a A G 2: 121,299,458 T252A probably damaging Het
Mrgpra1 C A 7: 47,335,455 A159S probably benign Het
Ndst3 T C 3: 123,601,482 I500V possibly damaging Het
Nhsl1 A G 10: 18,531,686 T1523A possibly damaging Het
Nr2f1 A G 13: 78,195,179 I322T probably damaging Het
Nup210 T C 6: 91,087,966 E184G probably damaging Het
Obsl1 C T 1: 75,493,946 W1022* probably null Het
Olfr1250 T A 2: 89,656,502 H313L probably benign Het
Olfr166 T A 16: 19,487,699 I287N probably damaging Het
Olfr470 A T 7: 107,845,365 Y123N probably damaging Het
Olfr551 G T 7: 102,587,955 Q263K possibly damaging Het
Olfr802 A T 10: 129,682,280 I153N probably damaging Het
Olfr808 T A 10: 129,767,851 Y118* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Parp8 A G 13: 116,894,925 L417P possibly damaging Het
Pdia6 A G 12: 17,274,508 Q120R probably benign Het
Ppp3cc T C 14: 70,240,803 N290S probably benign Het
Prdm5 C A 6: 65,831,260 S63R possibly damaging Het
Prr14l T C 5: 32,831,101 D350G probably benign Het
Pwwp2a T C 11: 43,717,051 L497S probably damaging Het
R3hdm2 A G 10: 127,476,678 N430D probably benign Het
Rad51ap2 A G 12: 11,457,343 N422S possibly damaging Het
Rbbp8 G A 18: 11,672,581 probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,918 probably benign Het
Slc22a6 G A 19: 8,622,158 probably null Het
Slc28a3 T A 13: 58,566,231 E440V possibly damaging Het
Slc30a5 A T 13: 100,811,424 I482K probably damaging Het
Slco1a1 A T 6: 141,924,497 F305Y probably damaging Het
Slco4c1 T C 1: 96,828,965 N544S probably damaging Het
Smpd4 T A 16: 17,641,783 I656N probably damaging Het
Taok1 A T 11: 77,541,674 L771* probably null Het
Tmem231 T C 8: 111,915,295 D209G possibly damaging Het
Tmem25 A G 9: 44,795,408 probably null Het
Tmem79 T C 3: 88,333,411 T77A probably benign Het
Topbp1 A T 9: 103,328,637 T825S probably damaging Het
Trpm6 A T 19: 18,876,091 Q1825L probably benign Het
Uba1y T A Y: 821,348 D110E probably damaging Het
Utrn A T 10: 12,385,536 N3422K probably benign Het
Vmn1r219 A T 13: 23,163,144 M168L probably benign Het
Vmn2r62 T C 7: 42,764,811 H736R possibly damaging Het
Wdr1 T C 5: 38,540,092 H291R possibly damaging Het
Zan T C 5: 137,415,139 T3177A unknown Het
Zbtb21 T C 16: 97,951,295 H596R possibly damaging Het
Other mutations in Itgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
barely UTSW 10 77548536 splice site probably benign
joker UTSW 10 77549849 intron probably benign
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
Only_just UTSW 10 77549968 missense possibly damaging 0.80
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 critical splice donor site probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGGTCCTTAGTCCAC -3'
(R):5'- ACTTGCATTATGGCATCCAGC -3'

Sequencing Primer
(F):5'- CCACTGGAAGGTTCACTGTCATG -3'
(R):5'- TCAGGGGCGTCCAGGTTTC -3'
Posted On2019-06-26