Incidental Mutation 'R7305:R3hdm2'
ID567253
Institutional Source Beutler Lab
Gene Symbol R3hdm2
Ensembl Gene ENSMUSG00000025404
Gene NameR3H domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R7305 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127380327-127499384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127476678 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 430 (N430D)
Ref Sequence ENSEMBL: ENSMUSP00000069724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000166820] [ENSMUST00000169888] [ENSMUST00000170336]
Predicted Effect probably benign
Transcript: ENSMUST00000064793
AA Change: N430D

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404
AA Change: N430D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077046
AA Change: N462D

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404
AA Change: N462D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105249
AA Change: N444D

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404
AA Change: N444D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105250
AA Change: N444D

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404
AA Change: N444D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105251
AA Change: N444D

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404
AA Change: N444D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164831
AA Change: N430D

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404
AA Change: N430D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166820
AA Change: N462D

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404
AA Change: N462D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169888
AA Change: N195D

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404
AA Change: N195D

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170336
AA Change: N430D

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404
AA Change: N430D

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,119 I4019K probably benign Het
9130011E15Rik A T 19: 45,892,121 M508K probably benign Het
Abhd16b A T 2: 181,493,416 D37V possibly damaging Het
Ankhd1 A G 18: 36,632,205 D87G Het
Ankrd31 A G 13: 96,878,971 S1583G probably damaging Het
Ankub1 T C 3: 57,692,517 probably benign Het
Apba3 A G 10: 81,271,233 D264G probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cnot3 A T 7: 3,645,480 probably benign Het
Cxxc1 A G 18: 74,219,396 Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp3a57 A G 5: 145,370,985 I184V probably benign Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,623,355 probably null Het
Dab1 T A 4: 104,713,790 D210E Het
Elavl1 G A 8: 4,325,199 probably benign Het
Emilin1 C T 5: 30,917,089 Q225* probably null Het
Eml6 G T 11: 29,777,258 A1288E probably benign Het
Eno1 T C 4: 150,245,339 probably null Het
Eprs C T 1: 185,379,701 R303C probably damaging Het
Eps15l1 G A 8: 72,373,034 A651V probably benign Het
Etl4 A T 2: 20,709,557 I156F probably damaging Het
Faim2 A T 15: 99,513,933 I171N probably damaging Het
Fam105a A G 15: 27,658,233 C184R probably benign Het
Fam135a T A 1: 24,030,858 N381I probably damaging Het
Fam160a1 G T 3: 85,730,524 P156Q probably damaging Het
Fam71d A G 12: 78,715,035 K158E possibly damaging Het
Gabrg3 T A 7: 56,735,085 M243L probably benign Het
Gm5134 A G 10: 76,000,399 I405V probably damaging Het
Gm6614 G A 6: 141,992,494 A253V probably damaging Het
Gm9376 A T 14: 118,267,356 K67* probably null Het
Grm8 A T 6: 27,761,355 I290K possibly damaging Het
Hao1 T A 2: 134,548,201 M73L probably benign Het
Herc1 A G 9: 66,461,868 D452G Het
Idh3b C A 2: 130,281,493 K192N possibly damaging Het
Igkv6-23 A G 6: 70,260,569 S63P probably benign Het
Itgb2 A C 10: 77,548,564 D173A probably damaging Het
Jmjd8 A T 17: 25,830,327 T255S probably benign Het
Lamc3 A C 2: 31,930,702 E1243A probably benign Het
Map1a A G 2: 121,299,458 T252A probably damaging Het
Mrgpra1 C A 7: 47,335,455 A159S probably benign Het
Ndst3 T C 3: 123,601,482 I500V possibly damaging Het
Nhsl1 A G 10: 18,531,686 T1523A possibly damaging Het
Nr2f1 A G 13: 78,195,179 I322T probably damaging Het
Nup210 T C 6: 91,087,966 E184G probably damaging Het
Obsl1 C T 1: 75,493,946 W1022* probably null Het
Olfr1250 T A 2: 89,656,502 H313L probably benign Het
Olfr166 T A 16: 19,487,699 I287N probably damaging Het
Olfr470 A T 7: 107,845,365 Y123N probably damaging Het
Olfr551 G T 7: 102,587,955 Q263K possibly damaging Het
Olfr802 A T 10: 129,682,280 I153N probably damaging Het
Olfr808 T A 10: 129,767,851 Y118* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Parp8 A G 13: 116,894,925 L417P possibly damaging Het
Pdia6 A G 12: 17,274,508 Q120R probably benign Het
Ppp3cc T C 14: 70,240,803 N290S probably benign Het
Prdm5 C A 6: 65,831,260 S63R possibly damaging Het
Prr14l T C 5: 32,831,101 D350G probably benign Het
Pwwp2a T C 11: 43,717,051 L497S probably damaging Het
Rad51ap2 A G 12: 11,457,343 N422S possibly damaging Het
Rbbp8 G A 18: 11,672,581 probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,918 probably benign Het
Slc22a6 G A 19: 8,622,158 probably null Het
Slc28a3 T A 13: 58,566,231 E440V possibly damaging Het
Slc30a5 A T 13: 100,811,424 I482K probably damaging Het
Slco1a1 A T 6: 141,924,497 F305Y probably damaging Het
Slco4c1 T C 1: 96,828,965 N544S probably damaging Het
Smpd4 T A 16: 17,641,783 I656N probably damaging Het
Taok1 A T 11: 77,541,674 L771* probably null Het
Tmem231 T C 8: 111,915,295 D209G possibly damaging Het
Tmem25 A G 9: 44,795,408 probably null Het
Tmem79 T C 3: 88,333,411 T77A probably benign Het
Topbp1 A T 9: 103,328,637 T825S probably damaging Het
Trpm6 A T 19: 18,876,091 Q1825L probably benign Het
Uba1y T A Y: 821,348 D110E probably damaging Het
Utrn A T 10: 12,385,536 N3422K probably benign Het
Vmn1r219 A T 13: 23,163,144 M168L probably benign Het
Vmn2r62 T C 7: 42,764,811 H736R possibly damaging Het
Wdr1 T C 5: 38,540,092 H291R possibly damaging Het
Zan T C 5: 137,415,139 T3177A unknown Het
Zbtb21 T C 16: 97,951,295 H596R possibly damaging Het
Other mutations in R3hdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:R3hdm2 APN 10 127458850 missense probably damaging 1.00
IGL02114:R3hdm2 APN 10 127484109 missense probably damaging 0.99
IGL02116:R3hdm2 APN 10 127498552 missense probably damaging 1.00
IGL02549:R3hdm2 APN 10 127484225 splice site probably benign
IGL02647:R3hdm2 APN 10 127459484 missense probably damaging 1.00
IGL02696:R3hdm2 APN 10 127465019 splice site probably null
IGL02732:R3hdm2 APN 10 127484060 missense probably benign 0.43
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0132:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0157:R3hdm2 UTSW 10 127471989 missense probably damaging 0.99
R0179:R3hdm2 UTSW 10 127495106 missense probably damaging 1.00
R0196:R3hdm2 UTSW 10 127484521 missense probably damaging 1.00
R0401:R3hdm2 UTSW 10 127458173 missense possibly damaging 0.90
R0505:R3hdm2 UTSW 10 127457700 missense probably damaging 1.00
R0606:R3hdm2 UTSW 10 127444444 missense probably damaging 1.00
R1188:R3hdm2 UTSW 10 127452755 missense probably benign 0.02
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1503:R3hdm2 UTSW 10 127471826 nonsense probably null
R1584:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1652:R3hdm2 UTSW 10 127495091 missense probably benign 0.00
R1901:R3hdm2 UTSW 10 127498468 missense possibly damaging 0.91
R3735:R3hdm2 UTSW 10 127465010 missense probably benign
R5261:R3hdm2 UTSW 10 127498416 missense probably damaging 1.00
R5329:R3hdm2 UTSW 10 127458893 missense probably damaging 1.00
R5379:R3hdm2 UTSW 10 127471902 missense probably damaging 1.00
R5380:R3hdm2 UTSW 10 127485447 missense probably damaging 1.00
R5387:R3hdm2 UTSW 10 127485434 missense probably damaging 1.00
R5558:R3hdm2 UTSW 10 127444402 missense probably damaging 1.00
R5773:R3hdm2 UTSW 10 127444303 utr 5 prime probably benign
R5936:R3hdm2 UTSW 10 127471812 missense probably damaging 1.00
R6024:R3hdm2 UTSW 10 127459480 missense probably damaging 1.00
R6160:R3hdm2 UTSW 10 127484507 missense probably damaging 1.00
R6191:R3hdm2 UTSW 10 127484515 missense probably damaging 1.00
R7058:R3hdm2 UTSW 10 127484513 missense probably damaging 1.00
R7224:R3hdm2 UTSW 10 127458153 missense probably damaging 1.00
R7253:R3hdm2 UTSW 10 127481775 missense probably damaging 1.00
R7349:R3hdm2 UTSW 10 127492646 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAATTCCATTTGCGCATTG -3'
(R):5'- AGGAATGTCTCAGCCAAACA -3'

Sequencing Primer
(F):5'- TACAACTTGGGGCGGGTCTC -3'
(R):5'- AAAACACTTGCCCCTGTCCTG -3'
Posted On2019-06-26