Incidental Mutation 'R7305:Zbtb21'
ID567277
Institutional Source Beutler Lab
Gene Symbol Zbtb21
Ensembl Gene ENSMUSG00000046962
Gene Namezinc finger and BTB domain containing 21
SynonymsZfp295, B430213I24Rik, 5430437K12Rik, Znf295
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R7305 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location97943357-97962622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97951295 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 596 (H596R)
Ref Sequence ENSEMBL: ENSMUSP00000068283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052089] [ENSMUST00000063605] [ENSMUST00000113734] [ENSMUST00000231263] [ENSMUST00000231560] [ENSMUST00000232165] [ENSMUST00000232187]
Predicted Effect probably benign
Transcript: ENSMUST00000052089
SMART Domains Protein: ENSMUSP00000052127
Gene: ENSMUSG00000046962

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 578 598 2.14e2 SMART
ZnF_C2H2 605 628 8.67e-1 SMART
low complexity region 708 728 N/A INTRINSIC
ZnF_C2H2 737 757 2.06e1 SMART
ZnF_C2H2 765 787 4.65e-1 SMART
low complexity region 804 829 N/A INTRINSIC
ZnF_C2H2 871 893 1.79e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063605
AA Change: H596R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068283
Gene: ENSMUSG00000046962
AA Change: H596R

DomainStartEndE-ValueType
BTB 30 126 5.14e-18 SMART
low complexity region 433 442 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
ZnF_C2H2 549 572 8.09e-1 SMART
ZnF_C2H2 578 601 2.63e0 SMART
ZnF_C2H2 673 695 3.58e-2 SMART
ZnF_C2H2 750 770 2.14e2 SMART
ZnF_C2H2 777 800 8.67e-1 SMART
low complexity region 880 900 N/A INTRINSIC
ZnF_C2H2 909 929 2.06e1 SMART
ZnF_C2H2 937 959 4.65e-1 SMART
low complexity region 976 1001 N/A INTRINSIC
ZnF_C2H2 1043 1065 1.79e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113734
AA Change: H624R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109363
Gene: ENSMUSG00000046962
AA Change: H624R

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 577 600 8.09e-1 SMART
ZnF_C2H2 606 629 2.63e0 SMART
ZnF_C2H2 701 723 3.58e-2 SMART
ZnF_C2H2 778 798 2.14e2 SMART
ZnF_C2H2 805 828 8.67e-1 SMART
low complexity region 908 928 N/A INTRINSIC
ZnF_C2H2 937 957 2.06e1 SMART
ZnF_C2H2 965 987 4.65e-1 SMART
low complexity region 1004 1029 N/A INTRINSIC
ZnF_C2H2 1071 1093 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231263
Predicted Effect probably benign
Transcript: ENSMUST00000231560
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect probably benign
Transcript: ENSMUST00000232187
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,119 I4019K probably benign Het
9130011E15Rik A T 19: 45,892,121 M508K probably benign Het
Abhd16b A T 2: 181,493,416 D37V possibly damaging Het
Ankhd1 A G 18: 36,632,205 D87G Het
Ankrd31 A G 13: 96,878,971 S1583G probably damaging Het
Ankub1 T C 3: 57,692,517 probably benign Het
Apba3 A G 10: 81,271,233 D264G probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cnot3 A T 7: 3,645,480 probably benign Het
Cxxc1 A G 18: 74,219,396 Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp3a57 A G 5: 145,370,985 I184V probably benign Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,623,355 probably null Het
Dab1 T A 4: 104,713,790 D210E Het
Elavl1 G A 8: 4,325,199 probably benign Het
Emilin1 C T 5: 30,917,089 Q225* probably null Het
Eml6 G T 11: 29,777,258 A1288E probably benign Het
Eno1 T C 4: 150,245,339 probably null Het
Eprs C T 1: 185,379,701 R303C probably damaging Het
Eps15l1 G A 8: 72,373,034 A651V probably benign Het
Etl4 A T 2: 20,709,557 I156F probably damaging Het
Faim2 A T 15: 99,513,933 I171N probably damaging Het
Fam105a A G 15: 27,658,233 C184R probably benign Het
Fam135a T A 1: 24,030,858 N381I probably damaging Het
Fam160a1 G T 3: 85,730,524 P156Q probably damaging Het
Fam71d A G 12: 78,715,035 K158E possibly damaging Het
Gabrg3 T A 7: 56,735,085 M243L probably benign Het
Gm5134 A G 10: 76,000,399 I405V probably damaging Het
Gm6614 G A 6: 141,992,494 A253V probably damaging Het
Gm9376 A T 14: 118,267,356 K67* probably null Het
Grm8 A T 6: 27,761,355 I290K possibly damaging Het
Hao1 T A 2: 134,548,201 M73L probably benign Het
Herc1 A G 9: 66,461,868 D452G Het
Idh3b C A 2: 130,281,493 K192N possibly damaging Het
Igkv6-23 A G 6: 70,260,569 S63P probably benign Het
Itgb2 A C 10: 77,548,564 D173A probably damaging Het
Jmjd8 A T 17: 25,830,327 T255S probably benign Het
Lamc3 A C 2: 31,930,702 E1243A probably benign Het
Map1a A G 2: 121,299,458 T252A probably damaging Het
Mrgpra1 C A 7: 47,335,455 A159S probably benign Het
Ndst3 T C 3: 123,601,482 I500V possibly damaging Het
Nhsl1 A G 10: 18,531,686 T1523A possibly damaging Het
Nr2f1 A G 13: 78,195,179 I322T probably damaging Het
Nup210 T C 6: 91,087,966 E184G probably damaging Het
Obsl1 C T 1: 75,493,946 W1022* probably null Het
Olfr1250 T A 2: 89,656,502 H313L probably benign Het
Olfr166 T A 16: 19,487,699 I287N probably damaging Het
Olfr470 A T 7: 107,845,365 Y123N probably damaging Het
Olfr551 G T 7: 102,587,955 Q263K possibly damaging Het
Olfr802 A T 10: 129,682,280 I153N probably damaging Het
Olfr808 T A 10: 129,767,851 Y118* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Parp8 A G 13: 116,894,925 L417P possibly damaging Het
Pdia6 A G 12: 17,274,508 Q120R probably benign Het
Ppp3cc T C 14: 70,240,803 N290S probably benign Het
Prdm5 C A 6: 65,831,260 S63R possibly damaging Het
Prr14l T C 5: 32,831,101 D350G probably benign Het
Pwwp2a T C 11: 43,717,051 L497S probably damaging Het
R3hdm2 A G 10: 127,476,678 N430D probably benign Het
Rad51ap2 A G 12: 11,457,343 N422S possibly damaging Het
Rbbp8 G A 18: 11,672,581 probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,918 probably benign Het
Slc22a6 G A 19: 8,622,158 probably null Het
Slc28a3 T A 13: 58,566,231 E440V possibly damaging Het
Slc30a5 A T 13: 100,811,424 I482K probably damaging Het
Slco1a1 A T 6: 141,924,497 F305Y probably damaging Het
Slco4c1 T C 1: 96,828,965 N544S probably damaging Het
Smpd4 T A 16: 17,641,783 I656N probably damaging Het
Taok1 A T 11: 77,541,674 L771* probably null Het
Tmem231 T C 8: 111,915,295 D209G possibly damaging Het
Tmem25 A G 9: 44,795,408 probably null Het
Tmem79 T C 3: 88,333,411 T77A probably benign Het
Topbp1 A T 9: 103,328,637 T825S probably damaging Het
Trpm6 A T 19: 18,876,091 Q1825L probably benign Het
Uba1y T A Y: 821,348 D110E probably damaging Het
Utrn A T 10: 12,385,536 N3422K probably benign Het
Vmn1r219 A T 13: 23,163,144 M168L probably benign Het
Vmn2r62 T C 7: 42,764,811 H736R possibly damaging Het
Wdr1 T C 5: 38,540,092 H291R possibly damaging Het
Zan T C 5: 137,415,139 T3177A unknown Het
Other mutations in Zbtb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Zbtb21 APN 16 97952320 missense probably benign 0.03
IGL00921:Zbtb21 APN 16 97952022 missense probably damaging 1.00
IGL01825:Zbtb21 APN 16 97952689 missense possibly damaging 0.63
IGL02310:Zbtb21 APN 16 97951790 missense possibly damaging 0.89
IGL03126:Zbtb21 APN 16 97951745 missense probably damaging 1.00
IGL03332:Zbtb21 APN 16 97952333 missense possibly damaging 0.94
R0165:Zbtb21 UTSW 16 97951404 missense probably damaging 1.00
R0184:Zbtb21 UTSW 16 97950513 missense probably damaging 1.00
R0267:Zbtb21 UTSW 16 97952100 missense probably damaging 1.00
R0734:Zbtb21 UTSW 16 97952627 missense probably damaging 1.00
R1546:Zbtb21 UTSW 16 97952027 missense probably damaging 0.97
R1565:Zbtb21 UTSW 16 97952427 missense probably benign 0.00
R1778:Zbtb21 UTSW 16 97950585 missense probably benign 0.02
R2049:Zbtb21 UTSW 16 97950155 missense probably damaging 1.00
R4086:Zbtb21 UTSW 16 97952763 missense probably damaging 1.00
R4619:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4620:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4754:Zbtb21 UTSW 16 97951266 missense probably damaging 1.00
R4785:Zbtb21 UTSW 16 97950455 missense possibly damaging 0.60
R5466:Zbtb21 UTSW 16 97950498 missense possibly damaging 0.66
R5989:Zbtb21 UTSW 16 97951499 missense probably damaging 1.00
R6374:Zbtb21 UTSW 16 97950368 missense probably damaging 0.98
R6469:Zbtb21 UTSW 16 97956772 missense probably benign 0.01
R6732:Zbtb21 UTSW 16 97951082 missense probably damaging 0.97
R6830:Zbtb21 UTSW 16 97951961 missense probably damaging 1.00
R7123:Zbtb21 UTSW 16 97949912 missense probably damaging 0.96
R7129:Zbtb21 UTSW 16 97951687 small deletion probably benign
R7261:Zbtb21 UTSW 16 97952979 missense possibly damaging 0.46
R7372:Zbtb21 UTSW 16 97950369 missense possibly damaging 0.55
X0022:Zbtb21 UTSW 16 97952075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGATGACTTGCTGTGC -3'
(R):5'- CCTTGACAGCAACTTCCCAG -3'

Sequencing Primer
(F):5'- TGGGGAGCTACTCTGTCC -3'
(R):5'- TGACAGCAACTTCCCAGATTCTG -3'
Posted On2019-06-26