Incidental Mutation 'R7307:Hsd3b5'
ID567294
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms3(beta)HSDV
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location98618634-98630252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98619769 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 120 (F120L)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
Predicted Effect probably damaging
Transcript: ENSMUST00000044094
AA Change: F120L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: F120L

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98630057 missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98630098 missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98619123 missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98622159 missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98630105 missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98622027 missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98622131 missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98619144 missense probably benign
R0624:Hsd3b5 UTSW 3 98619404 missense probably damaging 0.98
R0745:Hsd3b5 UTSW 3 98619539 missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98619355 missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98630077 missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98619530 missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98622077 missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98619720 missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98619728 missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98619212 missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98619800 missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98622059 missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98619648 missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98619063 missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98619276 missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98619150 missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98630090 missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98622012 missense probably damaging 1.00
R7339:Hsd3b5 UTSW 3 98622074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTTCCCCATAGATGAAAGGG -3'
(R):5'- AGTGGGAATGCATTTAGCCTG -3'

Sequencing Primer
(F):5'- GCAAAGTGCCACCATTTTTCAGG -3'
(R):5'- CTGTAGTGGCCCTTTCACGG -3'
Posted On2019-06-26