Incidental Mutation 'R0637:Vmn2r2'
ID56730
Institutional Source Beutler Lab
Gene Symbol Vmn2r2
Ensembl Gene ENSMUSG00000043897
Gene Namevomeronasal 2, receptor 2
Synonyms
MMRRC Submission 038826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0637 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64116432-64140543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64126578 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 508 (T508S)
Ref Sequence ENSEMBL: ENSMUSP00000135110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077958] [ENSMUST00000177151]
Predicted Effect probably benign
Transcript: ENSMUST00000077958
AA Change: T424S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077109
Gene: ENSMUSG00000043897
AA Change: T424S

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 4.5e-80 PFAM
Pfam:NCD3G 458 511 8.3e-18 PFAM
Pfam:7tm_3 542 779 1.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177151
AA Change: T508S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135110
Gene: ENSMUSG00000043897
AA Change: T508S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 83 500 1.6e-84 PFAM
Pfam:NCD3G 542 595 2.6e-17 PFAM
Pfam:7tm_3 628 862 1.9e-47 PFAM
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,587,531 D285N probably damaging Het
Aldh3a1 G A 11: 61,215,478 probably benign Het
Alms1 A G 6: 85,623,033 T2083A possibly damaging Het
Atrip C T 9: 109,061,173 M143I possibly damaging Het
Aup1 T A 6: 83,056,861 V344D probably damaging Het
Baiap2 G A 11: 120,000,579 V511M probably benign Het
Bnip2 T A 9: 70,003,673 probably null Het
Cacna1i A T 15: 80,372,654 Y1083F probably damaging Het
Cbr4 T C 8: 61,490,706 probably benign Het
Ces2b C T 8: 104,834,605 probably benign Het
Chd1 A G 17: 15,742,288 N769S possibly damaging Het
Clca3b A T 3: 144,827,940 V558D probably benign Het
Col12a1 T C 9: 79,656,735 D1736G probably benign Het
Cpne8 C A 15: 90,648,621 C61F probably damaging Het
Cxcr1 A G 1: 74,192,839 I8T probably benign Het
D630003M21Rik T G 2: 158,195,407 probably benign Het
Dcaf17 T A 2: 71,060,419 D99E probably damaging Het
Fam60a A G 6: 148,930,665 probably benign Het
Fbf1 C T 11: 116,160,054 probably benign Het
Fgfr2 T A 7: 130,171,624 H570L possibly damaging Het
Gars G A 6: 55,069,487 probably null Het
Gm10309 A G 17: 86,499,035 probably benign Het
Gm13023 A T 4: 143,793,909 Y77F probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm9892 G A 8: 52,196,825 Q78* probably null Het
Has1 A G 17: 17,843,863 Y505H possibly damaging Het
Hivep3 T A 4: 120,132,541 L2063* probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Itgb3 T C 11: 104,658,876 V614A probably benign Het
Lrrc23 A G 6: 124,778,358 probably benign Het
Lrrc63 A T 14: 75,098,220 probably benign Het
Mfhas1 C T 8: 35,590,026 R357* probably null Het
Mink1 C A 11: 70,601,676 N123K probably damaging Het
Mtmr4 A G 11: 87,611,064 H591R probably benign Het
Nav3 T C 10: 109,770,197 T923A probably benign Het
Ncapg A G 5: 45,687,324 T554A probably damaging Het
Nfe2l1 T C 11: 96,827,688 Y7C probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Obscn A T 11: 59,051,644 M4904K probably damaging Het
Obscn G T 11: 59,082,776 L1910I probably damaging Het
Olfr890 T C 9: 38,143,882 F244S probably benign Het
Pcdhb15 T A 18: 37,475,566 V617E probably damaging Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Pgrmc1 T C X: 36,602,271 F160S probably damaging Het
Pink1 G T 4: 138,318,046 P239Q probably damaging Het
Prr27 A G 5: 87,851,146 probably benign Het
Rbpms G A 8: 33,806,836 P138S probably damaging Het
Rcc2 T C 4: 140,717,744 probably benign Het
Rgs3 T C 4: 62,646,673 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 C T 16: 73,001,951 T933M probably benign Het
Steap4 T C 5: 7,978,398 probably benign Het
Tenm3 T C 8: 48,236,525 Y2009C probably damaging Het
Tnr A C 1: 159,850,335 T97P possibly damaging Het
Topaz1 T A 9: 122,791,477 L1320* probably null Het
Topaz1 A G 9: 122,797,662 M1452V probably benign Het
Trank1 T G 9: 111,390,441 F2082C probably damaging Het
Trim24 C A 6: 37,958,559 probably null Het
Tspoap1 T A 11: 87,777,240 probably benign Het
Ubr4 T C 4: 139,399,615 L483P probably damaging Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp366 C A 13: 99,228,966 R212S probably damaging Het
Zkscan4 T A 13: 21,481,307 C122S probably damaging Het
Other mutations in Vmn2r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Vmn2r2 APN 3 64133898 splice site probably benign
IGL00980:Vmn2r2 APN 3 64117180 missense probably benign 0.11
IGL01389:Vmn2r2 APN 3 64117009 missense probably damaging 0.97
IGL01804:Vmn2r2 APN 3 64134256 missense possibly damaging 0.91
IGL02750:Vmn2r2 APN 3 64117402 missense probably damaging 1.00
IGL02829:Vmn2r2 APN 3 64118751 splice site probably benign
IGL03036:Vmn2r2 APN 3 64116900 missense probably benign 0.01
IGL03174:Vmn2r2 APN 3 64117123 nonsense probably null
PIT4151001:Vmn2r2 UTSW 3 64116913 missense possibly damaging 0.67
R0029:Vmn2r2 UTSW 3 64116944 missense probably benign 0.00
R0310:Vmn2r2 UTSW 3 64134618 missense probably damaging 1.00
R0357:Vmn2r2 UTSW 3 64133899 splice site probably null
R1626:Vmn2r2 UTSW 3 64134500 missense possibly damaging 0.61
R1662:Vmn2r2 UTSW 3 64117130 missense probably benign 0.00
R1710:Vmn2r2 UTSW 3 64117399 missense probably benign 0.19
R1797:Vmn2r2 UTSW 3 64134707 missense probably benign 0.00
R1862:Vmn2r2 UTSW 3 64134521 missense possibly damaging 0.79
R1971:Vmn2r2 UTSW 3 64126700 missense probably damaging 1.00
R2051:Vmn2r2 UTSW 3 64117345 missense possibly damaging 0.77
R2099:Vmn2r2 UTSW 3 64117053 missense probably damaging 1.00
R2275:Vmn2r2 UTSW 3 64116509 missense probably benign 0.00
R3078:Vmn2r2 UTSW 3 64134632 missense probably benign 0.22
R3418:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3419:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3959:Vmn2r2 UTSW 3 64140526 missense probably benign
R4230:Vmn2r2 UTSW 3 64134491 missense probably benign 0.00
R4258:Vmn2r2 UTSW 3 64134697 missense probably damaging 1.00
R4810:Vmn2r2 UTSW 3 64137462 missense probably damaging 1.00
R4822:Vmn2r2 UTSW 3 64134539 missense probably damaging 0.99
R4919:Vmn2r2 UTSW 3 64117157 missense possibly damaging 0.56
R4925:Vmn2r2 UTSW 3 64137471 start codon destroyed probably null 0.03
R4954:Vmn2r2 UTSW 3 64140484 missense probably benign 0.00
R5071:Vmn2r2 UTSW 3 64116900 missense probably benign 0.01
R5315:Vmn2r2 UTSW 3 64116956 missense probably benign 0.37
R5450:Vmn2r2 UTSW 3 64126590 missense probably benign
R5577:Vmn2r2 UTSW 3 64116995 missense probably benign 0.00
R5595:Vmn2r2 UTSW 3 64126615 missense possibly damaging 0.74
R5727:Vmn2r2 UTSW 3 64117187 missense probably benign 0.41
R5810:Vmn2r2 UTSW 3 64117394 missense probably damaging 1.00
R5919:Vmn2r2 UTSW 3 64137302 missense probably benign 0.39
R6052:Vmn2r2 UTSW 3 64117361 missense possibly damaging 0.56
R6084:Vmn2r2 UTSW 3 64117046 missense probably benign 0.01
R6299:Vmn2r2 UTSW 3 64116653 nonsense probably null
R6762:Vmn2r2 UTSW 3 64134449 missense probably damaging 1.00
R6858:Vmn2r2 UTSW 3 64137494 missense probably damaging 1.00
R6889:Vmn2r2 UTSW 3 64117267 missense probably damaging 0.99
R6990:Vmn2r2 UTSW 3 64117187 missense probably benign 0.02
R7195:Vmn2r2 UTSW 3 64116479 missense probably benign 0.01
R7269:Vmn2r2 UTSW 3 64126577 missense probably benign 0.32
X0024:Vmn2r2 UTSW 3 64137286 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ggggataggatggagggGAAACTG -3'
(R):5'- GAAATTGTCCATTGCCCAAAGTTAAGGAAA -3'

Sequencing Primer
(F):5'- TTGGAATATGGCAAAAATGTTAGGTG -3'
(R):5'- CATTGCCCAAAGTTAAGGAAAATAGG -3'
Posted On2013-07-11