Incidental Mutation 'R7307:Thra'
ID567330
Institutional Source Beutler Lab
Gene Symbol Thra
Ensembl Gene ENSMUSG00000058756
Gene Namethyroid hormone receptor alpha
SynonymsTR alpha 1, Thra2, Thra1, Rvr, TR alpha 2, c-erbAalpha, 6430529J03Rik, Erba, Nr1a1, T3Ralpha, T3R[a]
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R7307 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98740638-98769006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98764308 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 338 (I338T)
Ref Sequence ENSEMBL: ENSMUSP00000068281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064187] [ENSMUST00000064941] [ENSMUST00000103139] [ENSMUST00000124072]
Predicted Effect probably damaging
Transcript: ENSMUST00000064187
AA Change: I338T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068281
Gene: ENSMUSG00000058756
AA Change: I338T

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 1.43e-31 SMART
low complexity region 461 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064941
SMART Domains Protein: ENSMUSP00000069505
Gene: ENSMUSG00000020889

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
low complexity region 70 94 N/A INTRINSIC
ZnF_C4 130 202 5.54e-38 SMART
low complexity region 240 263 N/A INTRINSIC
PDB:3N00|A 282 361 2e-21 PDB
HOLI 442 600 4.2e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103139
AA Change: I338T

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099428
Gene: ENSMUSG00000058756
AA Change: I338T

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 7.26e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124072
AA Change: I338T

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115323
Gene: ENSMUSG00000058756
AA Change: I338T

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 2.36e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is one of several nuclear hormone receptors that bind thyroid hormones such as triiodothyronine and thyroxine with high affinity. The encoded protein is a transcription factor that can activate or repress transcription. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene result in diverse phenotypes depending on the location and severity of the mutation. Observed phenotypes may include alterations in thyroid physiology, intestinal remodeling, cerebellum development, bone growth, cardiac function, thermogenesis, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Thra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Thra APN 11 98762928 missense possibly damaging 0.90
IGL01544:Thra APN 11 98756928 missense possibly damaging 0.46
IGL02377:Thra APN 11 98761916 missense probably damaging 1.00
IGL02738:Thra APN 11 98764359 missense probably benign 0.40
IGL03111:Thra APN 11 98761029 unclassified probably benign
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0959:Thra UTSW 11 98753629 missense possibly damaging 0.94
R1659:Thra UTSW 11 98756979 missense probably damaging 0.99
R1839:Thra UTSW 11 98756143 missense probably benign 0.01
R1859:Thra UTSW 11 98756151 missense probably damaging 0.98
R1935:Thra UTSW 11 98763073 splice site probably benign
R1956:Thra UTSW 11 98763741 missense probably benign 0.03
R4584:Thra UTSW 11 98764484 missense probably benign 0.42
R4782:Thra UTSW 11 98756164 missense probably benign 0.01
R5414:Thra UTSW 11 98760957 missense probably benign 0.34
R5790:Thra UTSW 11 98762951 missense probably benign 0.20
R5927:Thra UTSW 11 98763688 missense possibly damaging 0.56
R7207:Thra UTSW 11 98760976 missense probably damaging 1.00
R7234:Thra UTSW 11 98763718 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGGATTGCTTCATGGCCGC -3'
(R):5'- TGGGGCACTCGACTTTCATG -3'

Sequencing Primer
(F):5'- AGTGTCCCTCCCTGAGC -3'
(R):5'- CACTCGACTTTCATGTGGAGGAAG -3'
Posted On2019-06-26