Incidental Mutation 'R7307:Zdhhc6'
ID567357
Institutional Source Beutler Lab
Gene Symbol Zdhhc6
Ensembl Gene ENSMUSG00000024982
Gene Namezinc finger, DHHC domain containing 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7307 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location55271291-55316032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55313250 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 100 (Y100H)
Ref Sequence ENSEMBL: ENSMUSP00000076157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076891] [ENSMUST00000095950] [ENSMUST00000223690] [ENSMUST00000223807] [ENSMUST00000224291] [ENSMUST00000224897] [ENSMUST00000225495] [ENSMUST00000225529] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably damaging
Transcript: ENSMUST00000076891
AA Change: Y100H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076157
Gene: ENSMUSG00000024982
AA Change: Y100H

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:zf-DHHC 94 244 3.2e-38 PFAM
SH3 316 397 5.84e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095950
SMART Domains Protein: ENSMUSP00000093644
Gene: ENSMUSG00000024983

DomainStartEndE-ValueType
Pfam:V-SNARE 12 90 7.3e-29 PFAM
t_SNARE 117 184 4.61e-10 SMART
low complexity region 193 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223690
Predicted Effect probably damaging
Transcript: ENSMUST00000223807
AA Change: Y100H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224291
AA Change: Y100H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000224897
AA Change: Y100H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225495
AA Change: Y100H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000225529
Predicted Effect probably damaging
Transcript: ENSMUST00000225963
AA Change: Y100H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000226103
AA Change: Y100H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Other mutations in Zdhhc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zdhhc6 APN 19 55309892 missense probably benign 0.19
IGL01419:Zdhhc6 APN 19 55309754 missense probably benign 0.09
IGL02598:Zdhhc6 APN 19 55314527 missense probably benign 0.31
Chalcogenide UTSW 19 55311701 missense probably damaging 1.00
telluride UTSW 19 55314566 start codon destroyed probably null 1.00
R0267:Zdhhc6 UTSW 19 55308930 missense probably benign 0.17
R0920:Zdhhc6 UTSW 19 55311701 missense probably damaging 1.00
R2143:Zdhhc6 UTSW 19 55298796 missense probably benign
R4445:Zdhhc6 UTSW 19 55302737 missense probably benign 0.31
R4446:Zdhhc6 UTSW 19 55302737 missense probably benign 0.31
R4632:Zdhhc6 UTSW 19 55314309 missense probably damaging 1.00
R4921:Zdhhc6 UTSW 19 55313210 missense probably damaging 0.96
R5144:Zdhhc6 UTSW 19 55314566 start codon destroyed probably null 1.00
R7067:Zdhhc6 UTSW 19 55304439 nonsense probably null
R7266:Zdhhc6 UTSW 19 55304500 missense probably damaging 1.00
R7326:Zdhhc6 UTSW 19 55302755 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATATTTCTGACAAGGTGAATGCC -3'
(R):5'- CAGGCGTTGAAAATGCAAGTTACTG -3'

Sequencing Primer
(F):5'- TCAGACCGGACTGTGGGAATTATC -3'
(R):5'- TTGAAAATGCAAGTTACTGGCCCC -3'
Posted On2019-06-26