Incidental Mutation 'R7308:Rdx'
ID567397
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Nameradixin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location52047173-52088735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52068870 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 254 (K254N)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: K254N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: K254N

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061352
AA Change: K254N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: K254N

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: K254N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: K254N

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 52086346 missense probably damaging 1.00
IGL02088:Rdx APN 9 52060883 utr 5 prime probably benign
IGL02522:Rdx APN 9 52068204 missense possibly damaging 0.92
R0731:Rdx UTSW 9 52068218 missense probably benign 0.05
R0748:Rdx UTSW 9 52064860 missense possibly damaging 0.87
R0831:Rdx UTSW 9 52065817 missense probably damaging 1.00
R1605:Rdx UTSW 9 52063591 missense probably damaging 1.00
R1688:Rdx UTSW 9 52060911 splice site probably benign
R2127:Rdx UTSW 9 52069732 missense possibly damaging 0.49
R2363:Rdx UTSW 9 52068873 missense probably damaging 1.00
R2899:Rdx UTSW 9 52068911 splice site probably benign
R4184:Rdx UTSW 9 52067380 missense probably damaging 1.00
R4569:Rdx UTSW 9 52068841 missense probably benign 0.07
R4607:Rdx UTSW 9 52068837 missense probably damaging 0.99
R4760:Rdx UTSW 9 52065874 missense probably benign 0.02
R4820:Rdx UTSW 9 52063591 missense probably damaging 1.00
R4966:Rdx UTSW 9 52075009 missense probably benign 0.00
R6707:Rdx UTSW 9 52063654 missense probably damaging 1.00
R7136:Rdx UTSW 9 52086445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGAGTCTTGGGCTCTTAAG -3'
(R):5'- GGGTTACCTCTACTACATTTTGCAATC -3'

Sequencing Primer
(F):5'- AGATTGGTCATTCATGTAACCTGTCC -3'
(R):5'- GCAATCAATAAGTGTTGTTAATACCC -3'
Posted On2019-06-26