Incidental Mutation 'R7308:Kcnma1'
ID567411
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23330935 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1022 (D1022N)
Ref Sequence ENSEMBL: ENSMUSP00000140275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794]
Predicted Effect probably damaging
Transcript: ENSMUST00000065788
AA Change: D838N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: D838N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074983
AA Change: D897N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142
AA Change: D897N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100831
AA Change: D868N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142
AA Change: D868N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.1e-18 PFAM
Pfam:Ion_trans_2 180 268 5.5e-16 PFAM
Pfam:TrkA_N 314 413 7.3e-7 PFAM
Pfam:BK_channel_a 411 509 6.2e-31 PFAM
low complexity region 865 873 N/A INTRINSIC
low complexity region 921 932 N/A INTRINSIC
low complexity region 1035 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112423
AA Change: D784N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: D784N

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145596
AA Change: D991N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000163322
AA Change: D835N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: D835N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 3.2e-18 PFAM
Pfam:Ion_trans_2 180 268 1.1e-15 PFAM
Pfam:TrkA_N 314 413 7e-7 PFAM
Pfam:BK_channel_a 411 509 6e-31 PFAM
low complexity region 832 840 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 1002 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172099
AA Change: D900N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142
AA Change: D900N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177634
AA Change: D865N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: D865N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179097
AA Change: D862N

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: D862N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179836
AA Change: D841N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142
AA Change: D841N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188210
AA Change: D922N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: D922N

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188285
AA Change: D1022N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: D1022N

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188991
AA Change: D1018N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: D1018N

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190044
AA Change: D960N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: D960N

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190985
Predicted Effect probably damaging
Transcript: ENSMUST00000223655
AA Change: D957N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223727
AA Change: D895N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223749
AA Change: D895N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224025
AA Change: D913N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224077
AA Change: D960N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224232
AA Change: D953N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224285
AA Change: D895N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224468
AA Change: D1025N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224787
AA Change: D844N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224812
AA Change: D928N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225315
AA Change: D924N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225431
AA Change: D895N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225471
AA Change: D924N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225556
AA Change: D901N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225794
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
PIT4495001:Kcnma1 UTSW 14 23425597 missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23309035 splice site probably null
PIT4576001:Kcnma1 UTSW 14 23309035 splice site probably null
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23314175 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23803162 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5705:Kcnma1 UTSW 14 24003771 missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23386351 nonsense probably null
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23494643 missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23463156 missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23367494 missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23526623 missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23309015 makesense probably null
Predicted Primers PCR Primer
(F):5'- CATGCACAGTTCAAGTTCCTG -3'
(R):5'- CACTTGATCCCAGTGCTTGC -3'

Sequencing Primer
(F):5'- ACAGTTCAAGTTCCTGCCAGTATC -3'
(R):5'- GATCCCAGTGCTTGCCAACC -3'
Posted On2019-06-26