Incidental Mutation 'R7309:4932414N04Rik'
ID567428
Institutional Source Beutler Lab
Gene Symbol 4932414N04Rik
Ensembl Gene ENSMUSG00000079324
Gene NameRIKEN cDNA 4932414N04 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7309 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location68656486-68748467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68716186 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 71 (I71L)
Ref Sequence ENSEMBL: ENSMUSP00000135792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055930] [ENSMUST00000128259]
Predicted Effect probably benign
Transcript: ENSMUST00000055930
AA Change: I71L

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059809
Gene: ENSMUSG00000079324
AA Change: I71L

DomainStartEndE-ValueType
coiled coil region 154 241 N/A INTRINSIC
Pfam:DUF3496 265 361 8.5e-12 PFAM
internal_repeat_1 456 597 1.76e-26 PROSPERO
internal_repeat_1 601 737 1.76e-26 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000128259
AA Change: I71L

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135792
Gene: ENSMUSG00000079324
AA Change: I71L

DomainStartEndE-ValueType
internal_repeat_1 5 39 6.02e-5 PROSPERO
internal_repeat_1 209 242 6.02e-5 PROSPERO
low complexity region 286 297 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in 4932414N04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:4932414N04Rik APN 2 68732875 missense probably benign 0.02
IGL01384:4932414N04Rik APN 2 68745405 missense possibly damaging 0.53
IGL02170:4932414N04Rik APN 2 68731123 missense probably benign 0.02
IGL02650:4932414N04Rik APN 2 68741537 missense probably benign 0.00
IGL02707:4932414N04Rik APN 2 68731130 missense possibly damaging 0.71
IGL02737:4932414N04Rik APN 2 68736560 missense possibly damaging 0.53
IGL03351:4932414N04Rik APN 2 68731083 missense probably benign
R0328:4932414N04Rik UTSW 2 68744280 missense possibly damaging 0.53
R0362:4932414N04Rik UTSW 2 68732917 missense probably benign 0.00
R0638:4932414N04Rik UTSW 2 68717228 missense probably benign 0.18
R1201:4932414N04Rik UTSW 2 68716282 missense possibly damaging 0.53
R1381:4932414N04Rik UTSW 2 68731086 missense probably benign 0.18
R1456:4932414N04Rik UTSW 2 68716214 missense possibly damaging 0.86
R2001:4932414N04Rik UTSW 2 68741456 missense probably benign
R2051:4932414N04Rik UTSW 2 68711048 missense possibly damaging 0.72
R2228:4932414N04Rik UTSW 2 68729591 missense probably benign 0.00
R2292:4932414N04Rik UTSW 2 68732139 missense probably benign 0.00
R2357:4932414N04Rik UTSW 2 68739500 missense possibly damaging 0.86
R2484:4932414N04Rik UTSW 2 68711475 missense possibly damaging 0.85
R3035:4932414N04Rik UTSW 2 68745418 missense probably benign 0.00
R3916:4932414N04Rik UTSW 2 68731985 missense possibly damaging 0.71
R3950:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3951:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3952:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R4091:4932414N04Rik UTSW 2 68745378 missense possibly damaging 0.73
R4118:4932414N04Rik UTSW 2 68736513 missense probably benign
R4153:4932414N04Rik UTSW 2 68668597 intron probably benign
R4210:4932414N04Rik UTSW 2 68659878 start gained probably benign
R4614:4932414N04Rik UTSW 2 68745460 missense probably benign 0.01
R4818:4932414N04Rik UTSW 2 68741466 missense probably benign
R5202:4932414N04Rik UTSW 2 68731964 missense probably benign
R5466:4932414N04Rik UTSW 2 68711389 missense probably benign 0.11
R5585:4932414N04Rik UTSW 2 68741426 missense probably benign 0.00
R5602:4932414N04Rik UTSW 2 68748368 makesense probably null
R5846:4932414N04Rik UTSW 2 68732033 missense unknown
R5902:4932414N04Rik UTSW 2 68708937 start codon destroyed probably null
R6002:4932414N04Rik UTSW 2 68662424 splice site probably null
R6029:4932414N04Rik UTSW 2 68694026 splice site probably null
R6093:4932414N04Rik UTSW 2 68659870 splice site probably benign
R6168:4932414N04Rik UTSW 2 68741483 missense possibly damaging 0.86
R6300:4932414N04Rik UTSW 2 68731109 missense possibly damaging 0.96
R6322:4932414N04Rik UTSW 2 68729499 missense probably benign 0.00
R6533:4932414N04Rik UTSW 2 68716318 nonsense probably null
R6547:4932414N04Rik UTSW 2 68659907 utr 5 prime probably benign
R7400:4932414N04Rik UTSW 2 68666203 missense unknown
X0025:4932414N04Rik UTSW 2 68729016 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTGTAGGCACTCAGTTTGC -3'
(R):5'- TATTTCCCGCAAGACTCCGTG -3'

Sequencing Primer
(F):5'- GCAGCTGTTTACCATGAATGACAGAC -3'
(R):5'- TTCACACCTCTGCAGAGCGAG -3'
Posted On2019-06-26