Incidental Mutation 'R7309:Ntrk1'
ID567432
Institutional Source Beutler Lab
Gene Symbol Ntrk1
Ensembl Gene ENSMUSG00000028072
Gene Nameneurotrophic tyrosine kinase, receptor, type 1
SynonymsTkr, TrkA
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7309 (G1)
Quality Score170.009
Status Not validated
Chromosome3
Chromosomal Location87778244-87795162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87795077 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 23 (M23K)
Ref Sequence ENSEMBL: ENSMUSP00000029712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029712] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
Predicted Effect probably benign
Transcript: ENSMUST00000029711
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029712
AA Change: M23K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029712
Gene: ENSMUSG00000028072
AA Change: M23K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LRR_8 91 150 8.9e-14 PFAM
Pfam:TPKR_C2 151 194 4.9e-15 PFAM
IG 202 285 3.2e-2 SMART
low complexity region 419 442 N/A INTRINSIC
TyrKc 513 784 2.31e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107582
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine kinase receptor (NTKR) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. The presence of this kinase leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in this gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. Alternate transcriptional splice variants of this gene have been found, but only three have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations result in premature death due to severe sensory and sympathetic neuropathies. A conditional mutant mouse exhibits defects in mast cell and B cell physiology. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Comp A T 8: 70,373,678 probably null Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Esf1 A T 2: 140,125,091 probably null Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mpdz A T 4: 81,381,958 probably null Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Pkd1l3 A G 8: 109,648,261 probably null Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sgsm1 A T 5: 113,268,846 probably null Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Stat1 A G 1: 52,126,621 probably null Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Ntrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ntrk1 APN 3 87791438 missense possibly damaging 0.94
IGL00756:Ntrk1 APN 3 87783697 missense probably benign 0.05
IGL01340:Ntrk1 APN 3 87788714 missense possibly damaging 0.72
IGL02262:Ntrk1 APN 3 87781797 missense probably damaging 1.00
IGL02268:Ntrk1 APN 3 87781531 missense probably damaging 1.00
IGL02290:Ntrk1 APN 3 87781771 missense probably benign 0.11
IGL02435:Ntrk1 APN 3 87788732 missense probably benign 0.01
IGL03007:Ntrk1 APN 3 87782743 missense possibly damaging 0.56
PIT4802001:Ntrk1 UTSW 3 87788634 missense probably damaging 0.98
R0015:Ntrk1 UTSW 3 87791750 intron probably benign
R0140:Ntrk1 UTSW 3 87778568 missense probably damaging 1.00
R0269:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R0457:Ntrk1 UTSW 3 87791707 missense probably benign
R0617:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R1144:Ntrk1 UTSW 3 87781542 missense probably damaging 1.00
R1152:Ntrk1 UTSW 3 87778593 missense probably benign 0.33
R1439:Ntrk1 UTSW 3 87789611 splice site probably null
R1588:Ntrk1 UTSW 3 87780077 nonsense probably null
R1764:Ntrk1 UTSW 3 87780084 missense probably damaging 0.99
R1766:Ntrk1 UTSW 3 87778518 missense probably damaging 1.00
R1771:Ntrk1 UTSW 3 87789630 missense probably benign
R2264:Ntrk1 UTSW 3 87779634 critical splice donor site probably null
R2377:Ntrk1 UTSW 3 87791407 missense possibly damaging 0.70
R4059:Ntrk1 UTSW 3 87781479 missense probably damaging 1.00
R4950:Ntrk1 UTSW 3 87789611 splice site probably null
R5107:Ntrk1 UTSW 3 87794973 missense probably benign 0.01
R5805:Ntrk1 UTSW 3 87780172 missense probably damaging 1.00
R6073:Ntrk1 UTSW 3 87791370 splice site probably null
R6372:Ntrk1 UTSW 3 87786048 missense probably benign
R6894:Ntrk1 UTSW 3 87782802 missense probably damaging 1.00
R6972:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
R6973:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCCTACAGCAGCCAAG -3'
(R):5'- GTGGCTAGTCTTTAACACCGC -3'

Sequencing Primer
(F):5'- GTGAATGAGTGCGCGCC -3'
(R):5'- TAGTCTTTAACACCGCCCCGC -3'
Posted On2019-06-26