Incidental Mutation 'R7309:4930522L14Rik'
ID567437
Institutional Source Beutler Lab
Gene Symbol 4930522L14Rik
Ensembl Gene ENSMUSG00000072762
Gene NameRIKEN cDNA 4930522L14 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7309 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109735990-109751886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 109736953 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 346 (H346Q)
Ref Sequence ENSEMBL: ENSMUSP00000108166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100937] [ENSMUST00000112547]
Predicted Effect probably benign
Transcript: ENSMUST00000100937
SMART Domains Protein: ENSMUSP00000098497
Gene: ENSMUSG00000072762

DomainStartEndE-ValueType
KRAB 4 64 5.37e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112547
AA Change: H346Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108166
Gene: ENSMUSG00000072762
AA Change: H346Q

DomainStartEndE-ValueType
KRAB 4 66 7.19e-16 SMART
ZnF_C2H2 103 125 2.75e-3 SMART
ZnF_C2H2 131 153 1.72e-4 SMART
ZnF_C2H2 159 181 7.9e-4 SMART
ZnF_C2H2 187 209 1.04e-3 SMART
ZnF_C2H2 215 237 1.1e-2 SMART
ZnF_C2H2 243 265 3.89e-3 SMART
ZnF_C2H2 271 294 3.69e-4 SMART
ZnF_C2H2 300 322 5.9e-3 SMART
ZnF_C2H2 328 350 1.56e-2 SMART
ZnF_C2H2 356 378 1.18e-2 SMART
ZnF_C2H2 384 406 9.08e-4 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 2.61e-4 SMART
ZnF_C2H2 468 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.39e-3 SMART
ZnF_C2H2 525 547 1.4e-4 SMART
ZnF_C2H2 553 576 1.95e-3 SMART
ZnF_C2H2 582 604 5.14e-3 SMART
ZnF_C2H2 610 632 1.67e-2 SMART
ZnF_C2H2 638 660 1.72e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in 4930522L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02622:4930522L14Rik APN 5 109739235 missense possibly damaging 0.86
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0432:4930522L14Rik UTSW 5 109736919 missense probably damaging 1.00
R0463:4930522L14Rik UTSW 5 109737060 unclassified probably benign
R0891:4930522L14Rik UTSW 5 109736290 missense possibly damaging 0.47
R1289:4930522L14Rik UTSW 5 109736890 nonsense probably null
R1637:4930522L14Rik UTSW 5 109738992 missense probably benign 0.01
R1764:4930522L14Rik UTSW 5 109736789 missense probably benign 0.22
R1793:4930522L14Rik UTSW 5 109736278 missense probably damaging 1.00
R1860:4930522L14Rik UTSW 5 109736232 missense probably damaging 1.00
R1899:4930522L14Rik UTSW 5 109736798 missense probably benign 0.04
R2135:4930522L14Rik UTSW 5 109737643 missense probably benign 0.00
R2143:4930522L14Rik UTSW 5 109736750 missense probably damaging 1.00
R2877:4930522L14Rik UTSW 5 109738945 splice site probably benign
R3847:4930522L14Rik UTSW 5 109736324 unclassified probably null
R4431:4930522L14Rik UTSW 5 109736574 missense possibly damaging 0.47
R4578:4930522L14Rik UTSW 5 109736671 nonsense probably null
R4611:4930522L14Rik UTSW 5 109737393 missense probably benign 0.00
R4776:4930522L14Rik UTSW 5 109736873 missense probably benign 0.22
R4921:4930522L14Rik UTSW 5 109737796 missense probably benign 0.25
R4937:4930522L14Rik UTSW 5 109736201 missense probably benign 0.12
R4952:4930522L14Rik UTSW 5 109739197 critical splice donor site probably null
R4980:4930522L14Rik UTSW 5 109737426 missense probably damaging 1.00
R5079:4930522L14Rik UTSW 5 109737330 missense probably benign
R5088:4930522L14Rik UTSW 5 109736073 missense probably damaging 1.00
R5143:4930522L14Rik UTSW 5 109739198 critical splice donor site probably null
R5183:4930522L14Rik UTSW 5 109739305 missense probably damaging 1.00
R5461:4930522L14Rik UTSW 5 109736777 missense possibly damaging 0.74
R5498:4930522L14Rik UTSW 5 109737547 missense probably benign 0.05
R5576:4930522L14Rik UTSW 5 109737704 missense probably benign 0.00
R6081:4930522L14Rik UTSW 5 109739231 missense probably damaging 1.00
R6387:4930522L14Rik UTSW 5 109737015 missense possibly damaging 0.88
R6509:4930522L14Rik UTSW 5 109737384 nonsense probably null
R6585:4930522L14Rik UTSW 5 109737668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAAAAGCAAAGGTTTTACCA -3'
(R):5'- GCTTTTCATGGTCAACTTCGAAAAC -3'

Sequencing Primer
(F):5'- CATGTATTCGAAGTTGACGACG -3'
(R):5'- GCCTTTTCACACCAAGGTAATC -3'
Posted On2019-06-26