Incidental Mutation 'R7309:Cldnd2'
ID567441
Institutional Source Beutler Lab
Gene Symbol Cldnd2
Ensembl Gene ENSMUSG00000038973
Gene Nameclaudin domain containing 2
Synonyms1700071E18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7309 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43440782-43443334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43441709 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 22 (T22A)
Ref Sequence ENSEMBL: ENSMUSP00000037980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004729] [ENSMUST00000040227] [ENSMUST00000070518] [ENSMUST00000203633] [ENSMUST00000204680] [ENSMUST00000206196] [ENSMUST00000206286] [ENSMUST00000206741] [ENSMUST00000206839]
Predicted Effect probably benign
Transcript: ENSMUST00000004729
SMART Domains Protein: ENSMUSP00000004729
Gene: ENSMUSG00000004610

DomainStartEndE-ValueType
ETF 26 218 4.15e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000040227
AA Change: T22A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037980
Gene: ENSMUSG00000038973
AA Change: T22A

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 6 147 2.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070518
SMART Domains Protein: ENSMUSP00000068946
Gene: ENSMUSG00000004612

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 6 150 5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203633
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206196
Predicted Effect probably benign
Transcript: ENSMUST00000206286
Predicted Effect probably benign
Transcript: ENSMUST00000206411
Predicted Effect probably benign
Transcript: ENSMUST00000206741
Predicted Effect possibly damaging
Transcript: ENSMUST00000206839
AA Change: T22A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Cldnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:Cldnd2 APN 7 43441658 missense probably benign 0.04
R1836:Cldnd2 UTSW 7 43442925 missense possibly damaging 0.86
R4731:Cldnd2 UTSW 7 43442189 missense possibly damaging 0.71
R4732:Cldnd2 UTSW 7 43442189 missense possibly damaging 0.71
R4733:Cldnd2 UTSW 7 43442189 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTTGAGGTTGCCAGGCAA -3'
(R):5'- TAAAGGACATCTGGGTCTGCG -3'

Sequencing Primer
(F):5'- TACCTGTGATGTCCTTGG -3'
(R):5'- TGGAAGGCCCATCTGGAG -3'
Posted On2019-06-26