Incidental Mutation 'R7309:Olfr297'
ID567445
Institutional Source Beutler Lab
Gene Symbol Olfr297
Ensembl Gene ENSMUSG00000057067
Gene Nameolfactory receptor 297
SynonymsGA_x6K02T2NHDJ-9587747-9586815, MOR220-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7309 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86519968-86528497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86527141 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 128 (L128H)
Ref Sequence ENSEMBL: ENSMUSP00000134371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071112] [ENSMUST00000172965]
Predicted Effect probably damaging
Transcript: ENSMUST00000071112
AA Change: L128H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132942
Gene: ENSMUSG00000057067
AA Change: L128H

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.9e-45 PFAM
Pfam:7tm_1 39 288 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172965
AA Change: L128H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134371
Gene: ENSMUSG00000057067
AA Change: L128H

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.2e-46 PFAM
Pfam:7tm_1 39 288 2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Olfr297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr297 APN 7 86526778 missense probably benign 0.10
IGL01823:Olfr297 APN 7 86527041 missense probably damaging 1.00
PIT4378001:Olfr297 UTSW 7 86527098 missense possibly damaging 0.50
R0304:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R0737:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R2177:Olfr297 UTSW 7 86527662 missense probably benign 0.01
R2436:Olfr297 UTSW 7 86527383 missense probably damaging 0.99
R4289:Olfr297 UTSW 7 86527054 missense probably damaging 1.00
R4639:Olfr297 UTSW 7 86526761 start codon destroyed probably null 1.00
R5202:Olfr297 UTSW 7 86527116 missense probably damaging 1.00
R5782:Olfr297 UTSW 7 86527213 missense probably damaging 0.98
R6446:Olfr297 UTSW 7 86527102 missense possibly damaging 0.90
R6615:Olfr297 UTSW 7 86526912 missense probably benign 0.06
R6920:Olfr297 UTSW 7 86527314 missense probably benign 0.00
R7150:Olfr297 UTSW 7 86527114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTGACCAGACCCTGAAC -3'
(R):5'- GTAAGCCTCAGCAAAGCAGG -3'

Sequencing Primer
(F):5'- GGAATCTGTCCATCTTAGACATGTGC -3'
(R):5'- GCAGGCAGCTCACAGAAGAAC -3'
Posted On2019-06-26