Incidental Mutation 'R7309:Vps35'
ID567448
Institutional Source Beutler Lab
Gene Symbol Vps35
Ensembl Gene ENSMUSG00000031696
Gene NameVPS35 retromer complex component
SynonymsMem3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7309 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85260392-85299802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85274967 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 407 (D407E)
Ref Sequence ENSEMBL: ENSMUSP00000034131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131]
Predicted Effect probably benign
Transcript: ENSMUST00000034131
AA Change: D407E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696
AA Change: D407E

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Vps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Vps35 APN 8 85273463 splice site probably benign
IGL02604:Vps35 APN 8 85286389 missense probably damaging 1.00
IGL03278:Vps35 APN 8 85294961 unclassified probably benign
IGL03326:Vps35 APN 8 85274897 nonsense probably null
PIT4151001:Vps35 UTSW 8 85284048 missense possibly damaging 0.95
R0118:Vps35 UTSW 8 85294953 missense probably benign 0.04
R0226:Vps35 UTSW 8 85273575 missense probably damaging 0.97
R1079:Vps35 UTSW 8 85279054 missense probably damaging 1.00
R1477:Vps35 UTSW 8 85287800 missense probably damaging 1.00
R1969:Vps35 UTSW 8 85278994 missense possibly damaging 0.90
R2082:Vps35 UTSW 8 85263465 missense possibly damaging 0.95
R2156:Vps35 UTSW 8 85286500 missense probably benign 0.06
R2341:Vps35 UTSW 8 85274814 splice site probably benign
R3752:Vps35 UTSW 8 85274831 missense probably benign 0.34
R4589:Vps35 UTSW 8 85287702 missense probably damaging 1.00
R4745:Vps35 UTSW 8 85261262 missense probably benign
R4790:Vps35 UTSW 8 85278857 splice site probably null
R4827:Vps35 UTSW 8 85273557 missense possibly damaging 0.94
R4953:Vps35 UTSW 8 85281846 missense probably damaging 1.00
R6277:Vps35 UTSW 8 85261228 missense possibly damaging 0.80
R6291:Vps35 UTSW 8 85299457 start codon destroyed probably benign 0.07
R6434:Vps35 UTSW 8 85273495 missense possibly damaging 0.53
R7175:Vps35 UTSW 8 85263560 splice site probably null
R7206:Vps35 UTSW 8 85287721 missense probably damaging 1.00
X0020:Vps35 UTSW 8 85263421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCTAGAAGAGCATATCTGTGTTC -3'
(R):5'- TGCTTGACCTATTTCTTTAAATGTGT -3'

Sequencing Primer
(F):5'- CTCTTACCTGGTCCTGAGAGACG -3'
(R):5'- GTATTGCTACCAGTAGTGCA -3'
Posted On2019-06-26