Incidental Mutation 'R7309:Prr23a2'
ID567452
Institutional Source Beutler Lab
Gene Symbol Prr23a2
Ensembl Gene ENSMUSG00000063058
Gene Nameproline rich 23A, member 2
SynonymsGm6406
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R7309 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location98856494-98857374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98856974 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 128 (D128E)
Ref Sequence ENSEMBL: ENSMUSP00000071270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071302]
Predicted Effect probably benign
Transcript: ENSMUST00000071302
AA Change: D128E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071270
Gene: ENSMUSG00000063058
AA Change: D128E

DomainStartEndE-ValueType
Pfam:DUF2476 2 250 1.5e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Prr23a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Prr23a2 APN 9 98856961 missense probably benign 0.03
IGL01867:Prr23a2 APN 9 98857060 missense probably benign
R0542:Prr23a2 UTSW 9 98857033 missense probably benign 0.00
R0566:Prr23a2 UTSW 9 98856988 missense possibly damaging 0.95
R0831:Prr23a2 UTSW 9 98856864 missense probably damaging 1.00
R5382:Prr23a2 UTSW 9 98857176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCACCTCAGACATCAGC -3'
(R):5'- TTCCTGCAACAAAGGACTGGG -3'

Sequencing Primer
(F):5'- TGCAGTTGCCCCTGGATG -3'
(R):5'- GCACCCCTGGGATGGAG -3'
Posted On2019-06-26