Incidental Mutation 'R7309:Miox'
ID567461
Institutional Source Beutler Lab
Gene Symbol Miox
Ensembl Gene ENSMUSG00000022613
Gene Namemyo-inositol oxygenase
SynonymsC85427, 0610009I10Rik, RSOR, Aldrl6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7309 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89334398-89337015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89336049 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 148 (C148F)
Ref Sequence ENSEMBL: ENSMUSP00000023282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023282]
PDB Structure
Crystal structure of mouse myo-inositol oxygenase in complex with substrate [X-RAY DIFFRACTION]
Crystal structure of Mouse Myo-inositol oxygenase (re-refined) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023282
AA Change: C148F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023282
Gene: ENSMUSG00000022613
AA Change: C148F

DomainStartEndE-ValueType
Pfam:MIOX 31 285 2.1e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162033
SMART Domains Protein: ENSMUSP00000123732
Gene: ENSMUSG00000022613

DomainStartEndE-ValueType
Pfam:MIOX 1 53 7.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Comp A T 8: 70,373,678 probably null Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Esf1 A T 2: 140,125,091 probably null Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Mpdz A T 4: 81,381,958 probably null Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Pkd1l3 A G 8: 109,648,261 probably null Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sgsm1 A T 5: 113,268,846 probably null Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Stat1 A G 1: 52,126,621 probably null Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Miox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:Miox APN 15 89336084 missense possibly damaging 0.48
R0001:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0011:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0011:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0039:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0043:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0079:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0081:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0109:Miox UTSW 15 89335581 missense probably benign 0.17
R0109:Miox UTSW 15 89335581 missense probably benign 0.17
R0134:Miox UTSW 15 89334454 unclassified probably benign
R0166:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0172:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0173:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0225:Miox UTSW 15 89334454 unclassified probably benign
R0284:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0285:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0288:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0681:Miox UTSW 15 89336274 missense possibly damaging 0.48
R1383:Miox UTSW 15 89335042 missense probably damaging 1.00
R4620:Miox UTSW 15 89336121 missense probably benign 0.43
R5016:Miox UTSW 15 89335564 missense probably null 1.00
R5110:Miox UTSW 15 89335556 missense probably benign
R5393:Miox UTSW 15 89336247 nonsense probably null
R6136:Miox UTSW 15 89335321 missense probably damaging 1.00
R6339:Miox UTSW 15 89335499 nonsense probably null
R7402:Miox UTSW 15 89335003 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGATCTGGGGAAAATTATGGC -3'
(R):5'- TCTCTAGTCCACAGTGAGGC -3'

Sequencing Primer
(F):5'- ATCTGGGGAAAATTATGGCTCTGTG -3'
(R):5'- TCTGTGCTGCAATGATCAAGAGC -3'
Posted On2019-06-26