Incidental Mutation 'R7309:Slc25a27'
ID567466
Institutional Source Beutler Lab
Gene Symbol Slc25a27
Ensembl Gene ENSMUSG00000023912
Gene Namesolute carrier family 25, member 27
SynonymsD530043E16Rik, 3632410G24Rik, Ucp4, 9430092A03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7309 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43641900-43667015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43664192 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 59 (D59E)
Ref Sequence ENSEMBL: ENSMUSP00000024705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024705] [ENSMUST00000170988]
Predicted Effect probably benign
Transcript: ENSMUST00000024705
AA Change: D59E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024705
Gene: ENSMUSG00000023912
AA Change: D59E

DomainStartEndE-ValueType
Pfam:Mito_carr 15 119 1.4e-21 PFAM
Pfam:Mito_carr 122 221 2e-23 PFAM
Pfam:Mito_carr 224 319 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170988
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. Transcripts of this gene are only detected in brain tissue and are specifically modulated by various environmental conditions. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Slc25a27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc25a27 APN 17 43664089 missense probably benign 0.01
IGL01767:Slc25a27 APN 17 43664073 critical splice donor site probably null
IGL02207:Slc25a27 APN 17 43661684 missense probably damaging 1.00
IGL02218:Slc25a27 APN 17 43664073 critical splice donor site probably null
IGL02795:Slc25a27 APN 17 43647112 missense probably damaging 1.00
R0243:Slc25a27 UTSW 17 43643627 missense probably benign 0.03
R1591:Slc25a27 UTSW 17 43653424 missense probably benign 0.12
R2165:Slc25a27 UTSW 17 43657772 missense probably benign 0.00
R2974:Slc25a27 UTSW 17 43653371 missense probably damaging 1.00
R5087:Slc25a27 UTSW 17 43666930 missense probably damaging 1.00
R5888:Slc25a27 UTSW 17 43649694 missense probably damaging 1.00
R6283:Slc25a27 UTSW 17 43657730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCATCCAGCTGAAGAGAAAAG -3'
(R):5'- GAGGCTGCCATATTCTCCTAC -3'

Sequencing Primer
(F):5'- CATCCAGCTGAAGAGAAAAGCAAAG -3'
(R):5'- ACTTCAGAGGCTCCAAATCTTG -3'
Posted On2019-06-26