Incidental Mutation 'R0637:Rbpms'
ID56747
Institutional Source Beutler Lab
Gene Symbol Rbpms
Ensembl Gene ENSMUSG00000031586
Gene NameRNA binding protein gene with multiple splicing
Synonymshermes, 2700019M19Rik, 2010300K22Rik
MMRRC Submission 038826-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R0637 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location33782643-33929863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33806836 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 138 (P138S)
Ref Sequence ENSEMBL: ENSMUSP00000140387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033994] [ENSMUST00000033995] [ENSMUST00000053251] [ENSMUST00000182256] [ENSMUST00000182987] [ENSMUST00000183062] [ENSMUST00000183088] [ENSMUST00000183336] [ENSMUST00000191473]
Predicted Effect probably benign
Transcript: ENSMUST00000033994
SMART Domains Protein: ENSMUSP00000033994
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033995
AA Change: P138S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033995
Gene: ENSMUSG00000031586
AA Change: P138S

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053251
AA Change: P138S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055813
Gene: ENSMUSG00000031586
AA Change: P138S

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182184
Predicted Effect probably damaging
Transcript: ENSMUST00000182256
AA Change: P34S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138140
Gene: ENSMUSG00000031586
AA Change: P34S

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182926
Predicted Effect probably damaging
Transcript: ENSMUST00000182987
AA Change: P138S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138483
Gene: ENSMUSG00000031586
AA Change: P138S

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183062
AA Change: P34S
SMART Domains Protein: ENSMUSP00000138726
Gene: ENSMUSG00000031586
AA Change: P34S

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183088
AA Change: P136S

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138420
Gene: ENSMUSG00000031586
AA Change: P136S

DomainStartEndE-ValueType
RRM 23 95 7.84e-8 SMART
low complexity region 147 159 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183336
AA Change: P1S
SMART Domains Protein: ENSMUSP00000138533
Gene: ENSMUSG00000031586
AA Change: P1S

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191473
AA Change: P138S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140387
Gene: ENSMUSG00000031586
AA Change: P138S

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231786
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,587,531 D285N probably damaging Het
Aldh3a1 G A 11: 61,215,478 probably benign Het
Alms1 A G 6: 85,623,033 T2083A possibly damaging Het
Atrip C T 9: 109,061,173 M143I possibly damaging Het
Aup1 T A 6: 83,056,861 V344D probably damaging Het
Baiap2 G A 11: 120,000,579 V511M probably benign Het
Bnip2 T A 9: 70,003,673 probably null Het
Cacna1i A T 15: 80,372,654 Y1083F probably damaging Het
Cbr4 T C 8: 61,490,706 probably benign Het
Ces2b C T 8: 104,834,605 probably benign Het
Chd1 A G 17: 15,742,288 N769S possibly damaging Het
Clca3b A T 3: 144,827,940 V558D probably benign Het
Col12a1 T C 9: 79,656,735 D1736G probably benign Het
Cpne8 C A 15: 90,648,621 C61F probably damaging Het
Cxcr1 A G 1: 74,192,839 I8T probably benign Het
D630003M21Rik T G 2: 158,195,407 probably benign Het
Dcaf17 T A 2: 71,060,419 D99E probably damaging Het
Fam60a A G 6: 148,930,665 probably benign Het
Fbf1 C T 11: 116,160,054 probably benign Het
Fgfr2 T A 7: 130,171,624 H570L possibly damaging Het
Gars G A 6: 55,069,487 probably null Het
Gm10309 A G 17: 86,499,035 probably benign Het
Gm13023 A T 4: 143,793,909 Y77F probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm9892 G A 8: 52,196,825 Q78* probably null Het
Has1 A G 17: 17,843,863 Y505H possibly damaging Het
Hivep3 T A 4: 120,132,541 L2063* probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Itgb3 T C 11: 104,658,876 V614A probably benign Het
Lrrc23 A G 6: 124,778,358 probably benign Het
Lrrc63 A T 14: 75,098,220 probably benign Het
Mfhas1 C T 8: 35,590,026 R357* probably null Het
Mink1 C A 11: 70,601,676 N123K probably damaging Het
Mtmr4 A G 11: 87,611,064 H591R probably benign Het
Nav3 T C 10: 109,770,197 T923A probably benign Het
Ncapg A G 5: 45,687,324 T554A probably damaging Het
Nfe2l1 T C 11: 96,827,688 Y7C probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Obscn A T 11: 59,051,644 M4904K probably damaging Het
Obscn G T 11: 59,082,776 L1910I probably damaging Het
Olfr890 T C 9: 38,143,882 F244S probably benign Het
Pcdhb15 T A 18: 37,475,566 V617E probably damaging Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Pgrmc1 T C X: 36,602,271 F160S probably damaging Het
Pink1 G T 4: 138,318,046 P239Q probably damaging Het
Prr27 A G 5: 87,851,146 probably benign Het
Rcc2 T C 4: 140,717,744 probably benign Het
Rgs3 T C 4: 62,646,673 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 C T 16: 73,001,951 T933M probably benign Het
Steap4 T C 5: 7,978,398 probably benign Het
Tenm3 T C 8: 48,236,525 Y2009C probably damaging Het
Tnr A C 1: 159,850,335 T97P possibly damaging Het
Topaz1 T A 9: 122,791,477 L1320* probably null Het
Topaz1 A G 9: 122,797,662 M1452V probably benign Het
Trank1 T G 9: 111,390,441 F2082C probably damaging Het
Trim24 C A 6: 37,958,559 probably null Het
Tspoap1 T A 11: 87,777,240 probably benign Het
Ubr4 T C 4: 139,399,615 L483P probably damaging Het
Vmn2r2 T A 3: 64,126,578 T508S probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp366 C A 13: 99,228,966 R212S probably damaging Het
Zkscan4 T A 13: 21,481,307 C122S probably damaging Het
Other mutations in Rbpms
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4354001:Rbpms UTSW 8 33806838 missense possibly damaging 0.61
R1183:Rbpms UTSW 8 33804072 missense possibly damaging 0.83
R2850:Rbpms UTSW 8 33834377 missense possibly damaging 0.94
R6722:Rbpms UTSW 8 33834393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCGGAGAGGGAAACCATTCAC -3'
(R):5'- TCTGTTTCAGCAGGAAGTTCCCAC -3'

Sequencing Primer
(F):5'- GGGAAACCATTCACTTCCTGG -3'
(R):5'- TTCTTGGGTCCCCAGCTAAAAAG -3'
Posted On2013-07-11