Incidental Mutation 'R7310:Rif1'
ID567475
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Namereplication timing regulatory factor 1
Synonyms6530403D07Rik, 5730435J01Rik, D2Ertd145e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7310 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location52072832-52122383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52105619 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 950 (V950A)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112693]
Predicted Effect probably benign
Transcript: ENSMUST00000112693
AA Change: V950A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: V950A

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,880,268 Q192L possibly damaging Het
3110002H16Rik A G 18: 12,184,915 K362E probably benign Het
Abat G A 16: 8,605,593 R250Q probably null Het
Abcg3 A C 5: 104,966,766 F295C probably benign Het
Abl1 T C 2: 31,800,592 S708P possibly damaging Het
Acap2 A T 16: 31,108,154 Y489* probably null Het
Akr1c6 A T 13: 4,436,355 M54L probably benign Het
Arhgap5 A T 12: 52,542,487 probably null Het
Asap1 A G 15: 64,099,530 probably null Het
Atrnl1 A T 19: 57,642,424 N208Y possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,888,148 probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,888,173 probably benign Het
BC049762 A C 11: 51,254,647 W38G probably damaging Het
Bmi1 T C 2: 18,684,419 S305P probably benign Het
Bpifc T A 10: 85,963,027 I431F probably damaging Het
C130050O18Rik A T 5: 139,415,238 M349L probably benign Het
Cacna2d1 A T 5: 16,314,916 D428V probably damaging Het
Card14 A C 11: 119,326,179 Q363P probably null Het
Cdca2 A T 14: 67,713,224 L86H probably damaging Het
Cdh22 G T 2: 165,112,294 S769* probably null Het
Cep164 T C 9: 45,775,366 E690G probably damaging Het
Cluh A G 11: 74,669,459 H1304R probably benign Het
Daxx C A 17: 33,910,461 D5E possibly damaging Het
Dnah7c A G 1: 46,596,967 M1117V possibly damaging Het
Dusp27 G A 1: 166,098,731 T1104I possibly damaging Het
Entpd3 T A 9: 120,560,755 probably null Het
Esr1 G A 10: 4,939,259 A386T probably damaging Het
Etv5 G A 16: 22,401,737 P300L probably benign Het
Exoc3l A T 8: 105,293,708 L195Q probably damaging Het
Exog T C 9: 119,445,003 L18P unknown Het
Fgfr1 T A 8: 25,562,315 V219D probably benign Het
Gm28710 A G 5: 16,870,248 Y872C possibly damaging Het
Gna14 A T 19: 16,533,749 Q54L Het
Gnb5 T C 9: 75,314,288 L48P probably benign Het
Gpbp1 A G 13: 111,453,390 I57T probably benign Het
Hnrnpa1 T A 15: 103,241,457 D48E probably damaging Het
Hrc T A 7: 45,335,803 L126* probably null Het
Hspa8 T G 9: 40,803,408 D333E probably benign Het
Igsf3 T A 3: 101,431,579 V403D probably benign Het
Itga10 C A 3: 96,648,159 A143D probably damaging Het
Kdr T A 5: 75,944,325 I1082F probably damaging Het
Klk11 A T 7: 43,778,830 I242F probably damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Map1b G A 13: 99,433,655 P853S unknown Het
Mmp13 T C 9: 7,280,880 I421T possibly damaging Het
Mpeg1 A T 19: 12,462,251 T358S probably damaging Het
Mttp T C 3: 138,095,022 D759G probably damaging Het
Mup17 T A 4: 61,593,692 Y115F possibly damaging Het
Myo1a G T 10: 127,705,828 A79S probably damaging Het
Myo9a T A 9: 59,871,153 N1397K probably benign Het
Nadk2 T C 15: 9,103,381 probably null Het
Ncf1 A T 5: 134,221,761 S402T probably benign Het
Ndufb10 T C 17: 24,722,214 D145G probably damaging Het
Nlgn2 G A 11: 69,830,583 T163M possibly damaging Het
Nol4 A T 18: 22,770,744 H172Q Het
Nup205 T A 6: 35,225,969 D1370E possibly damaging Het
Olfr1447 A G 19: 12,901,273 F169S probably damaging Het
Olfr392 A C 11: 73,814,286 N265K probably damaging Het
Olfr613 T A 7: 103,552,685 I300N probably damaging Het
Pkd1l2 A G 8: 117,024,034 V1746A probably benign Het
Plin2 T A 4: 86,668,391 I68F probably benign Het
Proc A T 18: 32,135,899 M11K probably benign Het
Rnf208 C A 2: 25,243,575 P94T probably damaging Het
Rundc3b A T 5: 8,521,011 Y269* probably null Het
Senp7 T C 16: 56,186,082 V950A probably benign Het
Sipa1l1 T C 12: 82,372,495 V649A probably damaging Het
Sipa1l3 G T 7: 29,399,696 H383N probably benign Het
Slc12a5 G A 2: 164,992,440 V794M probably damaging Het
Slc7a7 A G 14: 54,379,025 I200T probably damaging Het
Spdye4b A C 5: 143,202,348 I199L probably damaging Het
Tle4 A T 19: 14,517,791 H191Q probably benign Het
Tnfsf13b C A 8: 10,031,651 S271* probably null Het
Tnks2 G A 19: 36,879,439 V855I probably benign Het
Trank1 T C 9: 111,367,126 L1406S probably damaging Het
Trhde T C 10: 114,800,573 E243G probably damaging Het
Trim25 A T 11: 89,015,782 N448I probably benign Het
Trim31 T A 17: 36,907,302 M308K probably benign Het
Ugt2b36 A T 5: 87,066,279 V502E possibly damaging Het
Usp10 A C 8: 119,941,605 D215A possibly damaging Het
Usp33 T G 3: 152,360,389 L102* probably null Het
Wdr12 A T 1: 60,082,575 C272* probably null Het
Xndc1 A C 7: 102,078,731 probably null Het
Zkscan2 T C 7: 123,490,053 I332V possibly damaging Het
Zswim5 A T 4: 116,984,688 T822S probably benign Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 intron probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 intron probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGAGAAATTGTTGCATGC -3'
(R):5'- AATAACCTTCGATTTTGTGCCC -3'

Sequencing Primer
(F):5'- ATGCCTACAGTTCAGCTATCTTGGAG -3'
(R):5'- ATTTTGTGCCCTTGTTTATTTTCAAG -3'
Posted On2019-06-26