Incidental Mutation 'R7311:2410089E03Rik'
ID567621
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7311 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8180915 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 291 (V291F)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect probably damaging
Transcript: ENSMUST00000110617
AA Change: V291F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: V291F

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,750 V118A probably benign Het
2810403A07Rik T C 3: 88,711,695 S569P probably damaging Het
Accsl C T 2: 93,865,815 G146D possibly damaging Het
Acsm1 A T 7: 119,638,082 H206L probably damaging Het
Acta2 A G 19: 34,241,786 Y339H probably damaging Het
Adcy2 T C 13: 68,630,954 D989G probably damaging Het
Ahnak G A 19: 9,002,143 A264T probably benign Het
Ahnak A G 19: 9,009,827 D2825G possibly damaging Het
AI464131 A G 4: 41,498,577 I351T probably damaging Het
Akt1 G T 12: 112,657,153 T291K probably damaging Het
Arhgap24 A G 5: 102,892,685 D589G probably damaging Het
B4galnt3 G A 6: 120,215,435 Q447* probably null Het
BC024063 C T 10: 82,110,159 R538C possibly damaging Het
Bod1l A G 5: 41,794,333 S2912P possibly damaging Het
Bysl A G 17: 47,601,785 V360A possibly damaging Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Ccdc57 G A 11: 120,873,741 P736L probably benign Het
Cep290 T A 10: 100,537,718 F1287I probably damaging Het
Cntn1 T C 15: 92,232,275 probably null Het
Col6a3 C T 1: 90,822,291 G274R probably damaging Het
Cyb5r4 T C 9: 87,055,782 C285R probably damaging Het
Cyp4f39 G A 17: 32,489,655 C392Y probably damaging Het
Dcun1d3 A T 7: 119,859,511 D100E probably damaging Het
Dhx58 A T 11: 100,698,171 D516E probably benign Het
Dock5 T A 14: 67,828,502 I351F probably benign Het
Elmod2 A C 8: 83,319,412 probably null Het
Endov G A 11: 119,507,251 A281T probably benign Het
Epyc A G 10: 97,649,700 M1V probably null Het
Espnl T A 1: 91,323,568 H128Q probably damaging Het
Fam20a A T 11: 109,674,628 C452* probably null Het
Fam241b A G 10: 62,108,954 V88A probably damaging Het
Fgd3 A T 13: 49,296,690 S28T possibly damaging Het
Fmn1 C A 2: 113,525,680 P920Q unknown Het
Gpr139 G C 7: 119,144,866 D165E probably benign Het
Hoxb1 A G 11: 96,367,101 T286A possibly damaging Het
Ifi204 T A 1: 173,759,568 E174D probably benign Het
Igf2bp2 A G 16: 22,061,882 I555T possibly damaging Het
Ighv1-85 A G 12: 116,000,179 I67T probably damaging Het
Ihh G C 1: 74,951,147 P23R unknown Het
Irx2 T C 13: 72,631,277 S227P probably damaging Het
Itga4 A G 2: 79,256,182 I68V probably benign Het
Jsrp1 T A 10: 80,812,072 T51S probably benign Het
Kifc2 G T 15: 76,662,810 G306V probably damaging Het
L3mbtl2 T A 15: 81,667,387 S85T possibly damaging Het
Lama1 T C 17: 67,767,385 S944P Het
Lama4 T A 10: 39,026,635 C202S probably damaging Het
Lrrc29 A G 8: 105,315,667 probably benign Het
Mkl2 T A 16: 13,405,854 Y866* probably null Het
Morc3 G A 16: 93,849,173 D218N probably damaging Het
N4bp2l1 G A 5: 150,572,924 T179I probably damaging Het
Narf A G 11: 121,249,150 E270G probably benign Het
Nsd2 A G 5: 33,892,036 D1205G probably damaging Het
Olfr235 T C 19: 12,268,704 V158A probably benign Het
Olfr417 T C 1: 174,369,193 V92A probably benign Het
Parl T C 16: 20,287,875 T195A probably benign Het
Phrf1 A G 7: 141,240,933 I158V unknown Het
Phtf1 T C 3: 103,997,664 F543L possibly damaging Het
Plod2 T A 9: 92,584,558 D190E probably damaging Het
Polr1a G T 6: 71,950,879 K871N possibly damaging Het
Ppp2r5a A T 1: 191,357,801 I252K probably damaging Het
Ptgir T A 7: 16,907,048 D88E probably damaging Het
Raly T C 2: 154,857,420 V48A probably damaging Het
Ripor1 T A 8: 105,617,815 L527* probably null Het
Rnf213 T C 11: 119,416,547 S678P Het
Rpf1 T A 3: 146,507,163 Q306L probably benign Het
Rpl14 T C 9: 120,574,105 I122T probably damaging Het
Scn9a C A 2: 66,484,404 A1657S possibly damaging Het
Serpinb10 A G 1: 107,546,747 Y213C probably damaging Het
Slc25a23 A G 17: 57,052,827 L308P probably damaging Het
Smg9 T A 7: 24,420,633 M387K probably benign Het
Socs3 G A 11: 117,967,788 P148L probably benign Het
Susd3 A G 13: 49,248,430 L14P probably benign Het
Syt14 T A 1: 192,980,550 M80L probably benign Het
Tmprss2 T A 16: 97,568,416 Y386F possibly damaging Het
Tmx3 T A 18: 90,540,071 S416T probably benign Het
Treh A G 9: 44,685,948 T555A probably benign Het
Ttc5 T G 14: 50,765,943 Q428P probably damaging Het
Vmn2r73 A G 7: 85,871,984 S259P possibly damaging Het
Vps4b A T 1: 106,791,704 V38E probably damaging Het
Wdr83 C A 8: 85,076,261 R177L probably benign Het
Zfp780b A G 7: 27,963,163 F656L possibly damaging Het
Zfp995 A T 17: 21,880,660 F198I probably benign Het
Zswim8 A T 14: 20,721,484 Y1495F probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGAGCAGCTTAAGCAGAGAATTG -3'
(R):5'- AGCAACTTTCAGAATTTACCAGGG -3'

Sequencing Primer
(F):5'- GCAGAGAATTGTGACAGTTGTC -3'
(R):5'- CTTTCAGAATTTACCAGGGAAAAAGG -3'
Posted On2019-06-26