Incidental Mutation 'R7312:Nbeal1'
ID567640
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7312 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 60237151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 684 (V684L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160980
SMART Domains Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 278 297 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dusp27 C T 1: 166,127,107 V25I probably damaging Het
Efl1 T A 7: 82,681,444 M275K probably benign Het
Erp29 G T 5: 121,445,329 A178D probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr566 T A 7: 102,856,499 Y261F probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
P2rx5 C A 11: 73,164,866 L50M probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Zscan4b A G 7: 10,900,940 S459P probably benign Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 unclassified probably null
Lampoon UTSW 1 60261586 critical splice donor site probably null
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- ACATCTGAAATTATCTAATGGCAGAC -3'
Posted On2019-06-26