Incidental Mutation 'R0637:Mink1'
ID56766
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission 038826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0637 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70601676 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 123 (N123K)
Ref Sequence ENSEMBL: ENSMUSP00000078234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072237
AA Change: N123K

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: N123K

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072873
AA Change: N123K

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: N123K

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079244
AA Change: N123K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: N123K

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102558
AA Change: N123K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: N123K

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102559
AA Change: N123K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: N123K

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133310
Predicted Effect probably benign
Transcript: ENSMUST00000136663
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,587,531 D285N probably damaging Het
Aldh3a1 G A 11: 61,215,478 probably benign Het
Alms1 A G 6: 85,623,033 T2083A possibly damaging Het
Atrip C T 9: 109,061,173 M143I possibly damaging Het
Aup1 T A 6: 83,056,861 V344D probably damaging Het
Baiap2 G A 11: 120,000,579 V511M probably benign Het
Bnip2 T A 9: 70,003,673 probably null Het
Cacna1i A T 15: 80,372,654 Y1083F probably damaging Het
Cbr4 T C 8: 61,490,706 probably benign Het
Ces2b C T 8: 104,834,605 probably benign Het
Chd1 A G 17: 15,742,288 N769S possibly damaging Het
Clca3b A T 3: 144,827,940 V558D probably benign Het
Col12a1 T C 9: 79,656,735 D1736G probably benign Het
Cpne8 C A 15: 90,648,621 C61F probably damaging Het
Cxcr1 A G 1: 74,192,839 I8T probably benign Het
D630003M21Rik T G 2: 158,195,407 probably benign Het
Dcaf17 T A 2: 71,060,419 D99E probably damaging Het
Fam60a A G 6: 148,930,665 probably benign Het
Fbf1 C T 11: 116,160,054 probably benign Het
Fgfr2 T A 7: 130,171,624 H570L possibly damaging Het
Gars G A 6: 55,069,487 probably null Het
Gm10309 A G 17: 86,499,035 probably benign Het
Gm13023 A T 4: 143,793,909 Y77F probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm9892 G A 8: 52,196,825 Q78* probably null Het
Has1 A G 17: 17,843,863 Y505H possibly damaging Het
Hivep3 T A 4: 120,132,541 L2063* probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Itgb3 T C 11: 104,658,876 V614A probably benign Het
Lrrc23 A G 6: 124,778,358 probably benign Het
Lrrc63 A T 14: 75,098,220 probably benign Het
Mfhas1 C T 8: 35,590,026 R357* probably null Het
Mtmr4 A G 11: 87,611,064 H591R probably benign Het
Nav3 T C 10: 109,770,197 T923A probably benign Het
Ncapg A G 5: 45,687,324 T554A probably damaging Het
Nfe2l1 T C 11: 96,827,688 Y7C probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Obscn A T 11: 59,051,644 M4904K probably damaging Het
Obscn G T 11: 59,082,776 L1910I probably damaging Het
Olfr890 T C 9: 38,143,882 F244S probably benign Het
Pcdhb15 T A 18: 37,475,566 V617E probably damaging Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Pgrmc1 T C X: 36,602,271 F160S probably damaging Het
Pink1 G T 4: 138,318,046 P239Q probably damaging Het
Prr27 A G 5: 87,851,146 probably benign Het
Rbpms G A 8: 33,806,836 P138S probably damaging Het
Rcc2 T C 4: 140,717,744 probably benign Het
Rgs3 T C 4: 62,646,673 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 C T 16: 73,001,951 T933M probably benign Het
Steap4 T C 5: 7,978,398 probably benign Het
Tenm3 T C 8: 48,236,525 Y2009C probably damaging Het
Tnr A C 1: 159,850,335 T97P possibly damaging Het
Topaz1 T A 9: 122,791,477 L1320* probably null Het
Topaz1 A G 9: 122,797,662 M1452V probably benign Het
Trank1 T G 9: 111,390,441 F2082C probably damaging Het
Trim24 C A 6: 37,958,559 probably null Het
Tspoap1 T A 11: 87,777,240 probably benign Het
Ubr4 T C 4: 139,399,615 L483P probably damaging Het
Vmn2r2 T A 3: 64,126,578 T508S probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp366 C A 13: 99,228,966 R212S probably damaging Het
Zkscan4 T A 13: 21,481,307 C122S probably damaging Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70610075 splice site probably null
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCTAAGGGATCATCTAGCCCCTGC -3'
(R):5'- TCAGAGTGAAGCTGAGGTACAGACC -3'

Sequencing Primer
(F):5'- GCTGTCTGACTCACACCAG -3'
(R):5'- GCTGAGGTACAGACCTTACCC -3'
Posted On2013-07-11