Incidental Mutation 'R7312:Erp29'
ID567660
Institutional Source Beutler Lab
Gene Symbol Erp29
Ensembl Gene ENSMUSG00000029616
Gene Nameendoplasmic reticulum protein 29
SynonymsPDI-Db, Erp31, 2810446M09Rik, Erp28, 1200015M03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R7312 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location121428590-121452506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121445329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 178 (A178D)
Ref Sequence ENSEMBL: ENSMUSP00000117347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042163] [ENSMUST00000052590] [ENSMUST00000111802] [ENSMUST00000130451] [ENSMUST00000153758]
Predicted Effect probably benign
Transcript: ENSMUST00000042163
SMART Domains Protein: ENSMUSP00000038977
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:NatB_MDM20 263 658 1.6e-121 PFAM
low complexity region 672 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
low complexity region 721 734 N/A INTRINSIC
low complexity region 915 935 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052590
SMART Domains Protein: ENSMUSP00000059275
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
SCOP:d1g7ea_ 35 52 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111802
SMART Domains Protein: ENSMUSP00000107433
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
SCOP:d1g7ea_ 35 50 5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130451
AA Change: A178D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117347
Gene: ENSMUSG00000029616
AA Change: A178D

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:ERp29_N 35 157 9.3e-61 PFAM
Pfam:ERp29 158 252 7.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153758
SMART Domains Protein: ENSMUSP00000122522
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
SCOP:d1g7ea_ 35 55 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172908
SMART Domains Protein: ENSMUSP00000134345
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which localizes to the lumen of the endoplasmic reticulum (ER). It is a member of the protein disulfide isomerase (PDI) protein family but lacks an active thioredoxin motif, suggesting that this protein does not function as a disulfide isomerase. The canonical protein dimerizes and is thought to play a role in the processing of secretory proteins within the ER. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dusp27 C T 1: 166,127,107 V25I probably damaging Het
Efl1 T A 7: 82,681,444 M275K probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr566 T A 7: 102,856,499 Y261F probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
P2rx5 C A 11: 73,164,866 L50M probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Zscan4b A G 7: 10,900,940 S459P probably benign Het
Other mutations in Erp29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Erp29 APN 5 121452242 missense probably benign 0.00
R4094:Erp29 UTSW 5 121452282 unclassified probably benign
R4711:Erp29 UTSW 5 121445230 missense possibly damaging 0.85
R4792:Erp29 UTSW 5 121447174 missense probably benign 0.01
R7107:Erp29 UTSW 5 121445318 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGGCCGTCAGGATGTTTAAGC -3'
(R):5'- AGTCTTCTACCTATTCCGGGATG -3'

Sequencing Primer
(F):5'- GCCGTCAGGATGTTTAAGCTCTTC -3'
(R):5'- TCTACCTATTCCGGGATGGGGAC -3'
Posted On2019-06-26