Incidental Mutation 'R7313:Nbeal1'
ID567702
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7313 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 60237151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 684 (V684L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160980
SMART Domains Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 278 297 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 unclassified probably null
Lampoon UTSW 1 60261586 critical splice donor site probably null
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- ACATCTGAAATTATCTAATGGCAGAC -3'
Posted On2019-06-26