Incidental Mutation 'R7313:Gm26558'
ID567708
Institutional Source Beutler Lab
Gene Symbol Gm26558
Ensembl Gene ENSMUSG00000097025
Gene Namepredicted gene, 26558
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7313 (G1)
Quality Score113.008
Status Not validated
Chromosome2
Chromosomal Location70661248-70662108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70661867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 81 (E81G)
Ref Sequence ENSEMBL: ENSMUSP00000137906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028509] [ENSMUST00000112201] [ENSMUST00000112205] [ENSMUST00000133432] [ENSMUST00000180559]
Predicted Effect probably benign
Transcript: ENSMUST00000028509
SMART Domains Protein: ENSMUSP00000028509
Gene: ENSMUSG00000014959

DomainStartEndE-ValueType
PDZ 5 75 8.14e-1 SMART
internal_repeat_1 107 196 4.52e-17 PROSPERO
low complexity region 236 252 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
low complexity region 333 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112201
SMART Domains Protein: ENSMUSP00000107820
Gene: ENSMUSG00000014959

DomainStartEndE-ValueType
Pfam:GRASP55_65 1 62 4.6e-11 PFAM
Pfam:GRASP55_65 49 185 1.9e-65 PFAM
low complexity region 216 232 N/A INTRINSIC
low complexity region 287 309 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112205
SMART Domains Protein: ENSMUSP00000107824
Gene: ENSMUSG00000014959

DomainStartEndE-ValueType
PDZ 5 75 3.9e-3 SMART
internal_repeat_1 107 196 7.65e-17 PROSPERO
low complexity region 236 252 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133432
SMART Domains Protein: ENSMUSP00000121549
Gene: ENSMUSG00000014959

DomainStartEndE-ValueType
PDZ 5 75 8.14e-1 SMART
internal_repeat_1 107 196 1.1e-15 PROSPERO
low complexity region 236 252 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000180559
AA Change: E81G
SMART Domains Protein: ENSMUSP00000137906
Gene: ENSMUSG00000097025
AA Change: E81G

DomainStartEndE-ValueType
low complexity region 57 67 N/A INTRINSIC
low complexity region 102 117 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 144 165 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Gm26558
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5150:Gm26558 UTSW 2 70661312 unclassified probably benign
R5186:Gm26558 UTSW 2 70661417 unclassified probably benign
R5291:Gm26558 UTSW 2 70661529 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGATAAGTCTTGTCTGCTCCGGG -3'
(R):5'- TTGCAAGCATCCAGGGGTAG -3'

Sequencing Primer
(F):5'- AGTGCCACGTCCCAAGAG -3'
(R):5'- GTAGCCGAGATGAACCGACAC -3'
Posted On2019-06-26