Incidental Mutation 'R7313:Padi2'
ID567724
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7313 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140932768 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 294 (F294I)
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably damaging
Transcript: ENSMUST00000030765
AA Change: F294I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927
AA Change: F294I

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2045:Padi2 UTSW 4 140937930 missense probably damaging 1.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3079:Padi2 UTSW 4 140949878 missense probably damaging 0.99
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4250:Padi2 UTSW 4 140906546 missense probably damaging 0.97
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5793:Padi2 UTSW 4 140933190 missense probably benign 0.04
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5929:Padi2 UTSW 4 140944537 critical splice donor site probably null
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6478:Padi2 UTSW 4 140917637 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACACGCAGAGACATGTGGTG -3'
(R):5'- GGTACTTTGTAAAGGTCACTGAGAC -3'

Sequencing Primer
(F):5'- AGCAGAGTTCATTTGCCCAG -3'
(R):5'- GGGTCATATAGCCGCTAAGTG -3'
Posted On2019-06-26