Incidental Mutation 'R7313:Akap9'
ID567726
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R7313 (G1)
Quality Score132.008
Status Not validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4004933 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1626 (T1626K)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492]
Predicted Effect probably damaging
Transcript: ENSMUST00000044492
AA Change: T1626K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: T1626K

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCAGCCCATGGTCTCAAG -3'
(R):5'- ACCACGTTACCAGCAGAATG -3'

Sequencing Primer
(F):5'- CTCAAGGGATTAAAAGAAATCTGCC -3'
(R):5'- CAGTGCCTATGAAAACGG -3'
Posted On2019-06-26