Incidental Mutation 'R7313:Dnah3'
ID567747
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7313 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119981344 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1995 (E1995G)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect probably benign
Transcript: ENSMUST00000046993
AA Change: E1995G

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: E1995G

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: E1984G

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 intron probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 unclassified probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAGGTGAGGAGCTTAAAGCC -3'
(R):5'- CCATGATTGTGCTGGGTCTGAC -3'

Sequencing Primer
(F):5'- GAGCTGGTAGTTCTTCCA -3'
(R):5'- GGTCTGACACATAGGCATTTTAG -3'
Posted On2019-06-26